mapping-illumina~bbmap

BBMap is a splice-aware global aligner for DNA and RNA sequencing reads. It can align reads from all major platforms – Illumina, 454, Sanger, Ion Torrent, Pac Bio, and Nanopore.

input_1:paired-end or single-end FASTQ(.gz) or FASTA(.gz) files

input_1/SRR1363434_10k_1.fastq

@SRR1363434.1 HWI-ST615:215:C0MJTACXX:2:1101:1323:2406 length=101
ATTCTTGCCAGCCTGGAACTTCTTCCTTCATACCGTGTCTCTTACGAGCAGCAAGAACAATTTCACCAGCCTTAGAGGTTGGGTCCAATGGGTCAGAACCT
+SRR1363434.1 HWI-ST615:215:C0MJTACXX:2:1101:1323:2406 length=101
CC@FFFFFHGHHHIJGIJJJJHJJJJJIJJJJJGIIGIJIJIJJJIGGIGJJJJIHIIFIJIJJJJJFFHHFDFCDDDEEEDDBDBDDDCDDACDCDDCA9
@SRR1363434.2 HWI-ST615:215:C0MJTACXX:2:1101:1379:2415 length=101
TTTCGTTCTTGATTAATGAAAACGTCCTTGGCAAATGCTTTCGCAGTAGTTAGTCTTCAATAAATCCAAGAATTTCACCTCTGACAATTGAATACTGATGC
+SRR1363434.2 HWI-ST615:215:C0MJTACXX:2:1101:1379:2415 length=101
CCCFFFFFHGHHHJJJJJJJJJJJEHIJJJJJJJJJJJJJJJJJJIGHIIIGJIJJIJIIIJIGIJJJJJJHHHHFHHDFFFFCEEEDDCCCDEDDEDCCC
@SRR1363434.3 HWI-ST615:215:C0MJTACXX:2:1101:1298:2472 length=101
CGCCAGTGCTCCAGTTGTTACCTGAGAATGAAGCTTGATCGGCTTTTATTCTTTCCTGATAGGACTCTGTAAGTGTTACTAAACACTAACCGGTGAAGGAA

input_1/SRR1363434_10k_2.fastq

@SRR1363434.1 HWI-ST615:215:C0MJTACXX:2:1101:1323:2406 length=101
GTCGTTTCTGAAGAACAAAGACCAGGTACTCCATTGTTTACCGTCAAGGCCTACTTGCCAGTTAACGAATCTTTCGGTTTCACTGGTGAATTGAGACAAGC
+SRR1363434.1 HWI-ST615:215:C0MJTACXX:2:1101:1323:2406 length=101
@@BFFFFFHHHHHJJJJJJJJJJIJJFHHIIJIJJJIIIIHIJHGIIJIJGIGIJIJJJGIFGGJJJHEFHCFFFFDCC@CDDCDBCCCCDED@CACCCBB
@SRR1363434.2 HWI-ST615:215:C0MJTACXX:2:1101:1379:2415 length=101
CTTCTGGCTAACCTTGAGTCCTTGTGGCTCTTGGCGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCGTATTGCTCGAATATATTAG
+SRR1363434.2 HWI-ST615:215:C0MJTACXX:2:1101:1379:2415 length=101
CCCFFFFFHHHGHJJJIJIIIJJJHIJIJJGIEIGIDGHIIIJFFHIJJJJHHJIHIJJJHFFFFFF>CCFEEECCDCDD?B?BDDDDCD@9CCDEEEEDE
@SRR1363434.3 HWI-ST615:215:C0MJTACXX:2:1101:1298:2472 length=101
GTAGTAATGGTTTCAAGGGTTATCGATCACAGACATCATTGGTACGATGTTGTCTCTGGAGCTGTTCTAGCATTTTTAGTCATTTATTGTTGCTGGAAATG

input_1/test.fastq

@SRR1363434.1 HWI-ST615:215:C0MJTACXX:2:1101:1323:2406 length=101
ATTCTTGCCAGCCTGGAACTTCTTCCTTCATACCGTGTCTCTTACGAGCAGCAAGAACAATTTCACCAGCCTTAGAGGTTGGGTCCAATGGGTCAGAACCT
+SRR1363434.1 HWI-ST615:215:C0MJTACXX:2:1101:1323:2406 length=101
CC@FFFFFHGHHHIJGIJJJJHJJJJJIJJJJJGIIGIJIJIJJJIGGIGJJJJIHIIFIJIJJJJJFFHHFDFCDDDEEEDDBDBDDDCDDACDCDDCA9
@SRR1363434.2 HWI-ST615:215:C0MJTACXX:2:1101:1379:2415 length=101
TTTCGTTCTTGATTAATGAAAACGTCCTTGGCAAATGCTTTCGCAGTAGTTAGTCTTCAATAAATCCAAGAATTTCACCTCTGACAATTGAATACTGATGC
+SRR1363434.2 HWI-ST615:215:C0MJTACXX:2:1101:1379:2415 length=101
CCCFFFFFHGHHHJJJJJJJJJJJEHIJJJJJJJJJJJJJJJJJJIGHIIIGJIJJIJIIIJIGIJJJJJJHHHHFHHDFFFFCEEEDDCCCDEDDEDCCC
@SRR1363434.3 HWI-ST615:215:C0MJTACXX:2:1101:1298:2472 length=101
CGCCAGTGCTCCAGTTGTTACCTGAGAATGAAGCTTGATCGGCTTTTATTCTTTCCTGATAGGACTCTGTAAGTGTTACTAAACACTAACCGGTGAAGGAA

input_1/test2.fastq.gz

input_2:reference genome file

input_2/ref.fasta

>chrI
CCACACCACACCCACACACCCACACACCACACCACACACCACACCACACCCACACACACA
CATCCTAACACTACCCTAACACAGCCCTAATCTAACCCTGGCCAACCTGTCTCTCAACTT
ACCCTCCATTACCCTGCCTCCACTCGTTACCCTGTCCCATTCAACCATACCACTCCGAAC
CACCATCCATCCCTCTACTTACTACCACTCACCCACCGTTACCCTCCAATTACCCATATC
CAACCCACTGCCACTTACCCTACCATTACCCTACCATCCACCATGACCTACTCACCATAC
TGTTCTTCTACCCACCATATTGAAACGCTAACAAATGATCGTAAATAACACACACGTGCT
TACCCTACCACTTTATACCACCACCACATGCCATACTCACCCTCACTTGTATACTGATTT
TACGTACGCACACGGATGCTACAGTATATACCATCTCAAACTTACCCTACTCTCAGATTC
CACTTCACTCCATGGCCCATCTCTCACTGAATCAGTACCAAATGCACTCACATCATTATG

Command

mapping-illumina~bbmap -c 18 -m 60 input_1/ input_2/ref.fasta

Output

output/SRR1363434_10k_1.fastq.bam

output/SRR1363434_10k_1.fastq.bam.summary_flagstat.tsv

Sample	
in total (QC-passed reads + QC-failed reads)	21923 + 77 
primary	19923 + 77 
secondary	2000 + 0 
supplementary	0 + 0 
duplicates	0 + 0 
primary duplicates	0 + 0 
mapped	18247 + 0 (83.23% : 0.00%)
primary mapped	16247 + 0 (81.55% : 0.00%)
paired in sequencing	19923 + 77

view all outputs

Log

Checking the realpath of input files.
0 input_1/
1 /yoshitake/test/mapping-illumina~bbmap/input_1/SRR1363434_10k_1.fastq
1 /yoshitake/test/mapping-illumina~bbmap/input_1/SRR1363434_10k_2.fastq
1 /yoshitake/test/mapping-illumina~bbmap/input_1/test.fastq
1 /yoshitake/test/mapping-illumina~bbmap/input_1/test2.fastq.gz
1 /yoshitake/test/mapping-illumina~bbmap/input_1/test.fa
0 input_2/ref.fasta
centos:centos6 quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1
using docker
+ set -o pipefail
+ exec
++ tee log.txt
+ LANG=C
+ threads=8
+ three=8
++ expr 8 / 2
+ threads2=4
++ expr 8 - 2
+ threads1=6
+ '[' 6 -lt 1 ']'
++ free -g
++ grep Mem
++ sed -e 's/Mem: *\([0-9]*\) .*/\1/'
+ memG=251
++ expr 251 '*' 3 / 4
+ memG3=188
+ echo '
#####SYSTEM ENVIRONMENT#####
  threads=8
  memory=251G
############################
'

#####SYSTEM ENVIRONMENT#####
  threads=8
  memory=251G
############################

++ date +%s
+ time0=1653639397
+ echo start at 1653639397
start at 1653639397
+ echo -e 'Checking paramter settings...\n'
Checking paramter settings...

+ indexing_param=k=13
+ mapping_param='semiperfectmode=t maxindel=16000 minid=0.76 ambiguous=all requirecorrectstrand=f'
+ out_files=
+ for i in '$opt_o'
+ out_files+=' rpkm=rpkm.tsv'
+ for i in '$opt_o'
+ out_files+=' covstats=covstats.tsv'
+ mapped_only_bam=ON
++ echo input_2/ref.fasta
++ grep '[.]gz$'
++ wc -l
++ true
+ '[' 0 = 1 ']'
+ ref=input_2/ref.fasta
++ date +%Y%m%d_%H%M%S_%3N
+ PPDOCNAME=pp20220527_171637_312_2636
+ echo pp20220527_171637_312_2636
+ docker run --name pp20220527_171637_312_2636 -v /yoshitake/test/mapping-illumina~bbmap:/yoshitake/test/mapping-illumina~bbmap -w /yoshitake/test/mapping-illumina~bbmap -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1 bbmap.sh threads=8 k=13 ref=input_2/ref.fasta
java -ea -Xmx109378m -Xms109378m -cp /usr/local/opt/bbmap-38.96-1/current/ align2.BBMap build=1 overwrite=true fastareadlen=500 threads=8 k=13 ref=input_2/ref.fasta
Executing align2.BBMap [build=1, overwrite=true, fastareadlen=500, threads=8, k=13, ref=input_2/ref.fasta]
Version 38.96

Set threads to 8
No output file.
NOTE:	Ignoring reference file because it already appears to have been processed.
NOTE:	If you wish to regenerate the index, please manually delete ref/genome/1/summary.txt
Set genome to 1

Loaded Reference:	0.105 seconds.
Loading index for chunk 1-1, build 1
Generated Index:	0.716 seconds.
No reads to process; quitting.

Total time:     	0.935 seconds.
+ cat
+ pppair1=()
+ pppair2=()
+ ppsingle=()
+ IFS=
+ read i
++ find input_1//
++ egrep '(_R1.*|_1)[.]f((ast|)(q|a)|na|sa)(|[.]gz)$'
++ echo input_1//SRR1363434_10k_1.fastq
++ egrep '_1[.]f((ast|)(q|a)|na|sa)(|[.]gz)$'
++ wc -l
+ '[' 1 = 1 ']'
++ echo input_1//SRR1363434_10k_1.fastq
++ sed 's/_1[.]\(f\(\(ast\|\)\(q\|a\)\|na\|sa\)\(\|[.]gz\)\)$/_2.\1/'
+ temppair2=input_1//SRR1363434_10k_2.fastq
+ '[' -e input_1//SRR1363434_10k_2.fastq ']'
+ pppair1+=("$i")
+ pppair2+=("$temppair2")
+ IFS=
+ read i
+ IFS=
+ read i
++ find input_1//
++ egrep '[.]f((ast|)(q|a)|na|sa)(|[.]gz)$'
+ ppinputcheck=0
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//SRR1363434_10k_1.fastq = input_1//SRR1363434_10k_1.fastq ']'
+ ppinputcheck=1
+ break
+ '[' 1 = 0 ']'
+ IFS=
+ read i
+ ppinputcheck=0
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//SRR1363434_10k_1.fastq = input_1//SRR1363434_10k_2.fastq ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//SRR1363434_10k_2.fastq = input_1//SRR1363434_10k_2.fastq ']'
+ ppinputcheck=1
+ break
+ '[' 1 = 0 ']'
+ IFS=
+ read i
+ ppinputcheck=0
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//SRR1363434_10k_1.fastq = input_1//test.fastq ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//SRR1363434_10k_2.fastq = input_1//test.fastq ']'
+ '[' 0 = 0 ']'
+ ppsingle+=("$i")
+ IFS=
+ read i
+ ppinputcheck=0
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//SRR1363434_10k_1.fastq = input_1//test2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//SRR1363434_10k_2.fastq = input_1//test2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//test.fastq = input_1//test2.fastq.gz ']'
+ '[' 0 = 0 ']'
+ ppsingle+=("$i")
+ IFS=
+ read i
+ ppinputcheck=0
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//SRR1363434_10k_1.fastq = input_1//test.fa ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//SRR1363434_10k_2.fastq = input_1//test.fa ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//test.fastq = input_1//test.fa ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//test2.fastq.gz = input_1//test.fa ']'
+ '[' 0 = 0 ']'
+ ppsingle+=("$i")
+ IFS=
+ read i
+ mkdir -p output
+ for i in '${ppsingle[@]:-}'
+ xargs -I '{}' -P 1 bash -c '{}'
++ basename input_1//test.fastq
+ prefix=output/test.fastq
+ local_out_files=' rpkm=output/test.fastq_rpkm.tsv covstats=output/test.fastq_covstats.tsv'
+ echo 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/mapping-illumina~bbmap/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  bbmap.sh ref="input_2/ref.fasta" threads="6" in="input_1//test.fastq" out="output/test.fastq".temp.bam semiperfectmode=t maxindel=16000 minid=0.76 ambiguous=all requirecorrectstrand=f  rpkm=output/test.fastq_rpkm.tsv covstats=output/test.fastq_covstats.tsv; PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/mapping-illumina~bbmap/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  bash run-samtools.sh "output/test.fastq".temp.bam "6" "ON"'
+ for i in '${ppsingle[@]:-}'
++ basename input_1//test2.fastq.gz
+ prefix=output/test2.fastq.gz
+ local_out_files=' rpkm=output/test2.fastq.gz_rpkm.tsv covstats=output/test2.fastq.gz_covstats.tsv'
+ echo 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/mapping-illumina~bbmap/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  bbmap.sh ref="input_2/ref.fasta" threads="6" in="input_1//test2.fastq.gz" out="output/test2.fastq.gz".temp.bam semiperfectmode=t maxindel=16000 minid=0.76 ambiguous=all requirecorrectstrand=f  rpkm=output/test2.fastq.gz_rpkm.tsv covstats=output/test2.fastq.gz_covstats.tsv; PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/mapping-illumina~bbmap/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  bash run-samtools.sh "output/test2.fastq.gz".temp.bam "6" "ON"'
+ for i in '${ppsingle[@]:-}'
++ basename input_1//test.fa
+ prefix=output/test.fa
+ local_out_files=' rpkm=output/test.fa_rpkm.tsv covstats=output/test.fa_covstats.tsv'
+ echo 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/mapping-illumina~bbmap/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  bbmap.sh ref="input_2/ref.fasta" threads="6" in="input_1//test.fa" out="output/test.fa".temp.bam semiperfectmode=t maxindel=16000 minid=0.76 ambiguous=all requirecorrectstrand=f  rpkm=output/test.fa_rpkm.tsv covstats=output/test.fa_covstats.tsv; PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/mapping-illumina~bbmap/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  bash run-samtools.sh "output/test.fa".temp.bam "6" "ON"'
+ (( i = 0 ))
+ (( i < 1 ))
++ basename input_1//SRR1363434_10k_1.fastq
+ prefix=output/SRR1363434_10k_1.fastq
+ local_out_files=' rpkm=output/SRR1363434_10k_1.fastq_rpkm.tsv covstats=output/SRR1363434_10k_1.fastq_covstats.tsv'
+ echo 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/mapping-illumina~bbmap/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  bbmap.sh ref="input_2/ref.fasta" threads="6" in1="input_1//SRR1363434_10k_1.fastq" in2="input_1//SRR1363434_10k_2.fastq" out="output/SRR1363434_10k_1.fastq".temp.bam semiperfectmode=t maxindel=16000 minid=0.76 ambiguous=all requirecorrectstrand=f  rpkm=output/SRR1363434_10k_1.fastq_rpkm.tsv covstats=output/SRR1363434_10k_1.fastq_covstats.tsv; PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/mapping-illumina~bbmap/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  bash run-samtools.sh "output/SRR1363434_10k_1.fastq".temp.bam "6" "ON"'
+ (( i++ ))
+ (( i < 1 ))
java -ea -Xmx109372m -Xms109372m -cp /usr/local/opt/bbmap-38.96-1/current/ align2.BBMap build=1 overwrite=true fastareadlen=500 ref=input_2/ref.fasta threads=6 in=input_1//test.fastq out=output/test.fastq.temp.bam semiperfectmode=t maxindel=16000 minid=0.76 ambiguous=all requirecorrectstrand=f rpkm=output/test.fastq_rpkm.tsv covstats=output/test.fastq_covstats.tsv
Executing align2.BBMap [build=1, overwrite=true, fastareadlen=500, ref=input_2/ref.fasta, threads=6, in=input_1//test.fastq, out=output/test.fastq.temp.bam, semiperfectmode=t, maxindel=16000, minid=0.76, ambiguous=all, requirecorrectstrand=f, rpkm=output/test.fastq_rpkm.tsv, covstats=output/test.fastq_covstats.tsv]
Version 38.96

Set threads to 6
Retaining all best sites for ambiguous mappings.
NOTE:	Ignoring reference file because it already appears to have been processed.
NOTE:	If you wish to regenerate the index, please manually delete ref/genome/1/summary.txt
Set genome to 1

Loaded Reference:	0.113 seconds.
Loading index for chunk 1-1, build 1
Generated Index:	0.744 seconds.
Analyzed Index:   	3.085 seconds.
Found samtools 1.15
Started output stream:	0.050 seconds.
Cleared Memory:    	0.185 seconds.
Processing reads in single-ended mode.
Started read stream.
Started 6 mapping threads.
Detecting finished threads: 0, 1, 2, 3, 4, 5

   ------------------   Results   ------------------   

Genome:                	1
Key Length:            	13
Max Indel:             	0
Minimum Score Ratio:  	0.45
Mapping Mode:         	semiperfect
Reads Used:           	10000	(1010000 bases)

Mapping:          	0.489 seconds.
Reads/sec:       	20430.25
kBases/sec:      	2063.46


Read 1 data:      	pct reads	num reads 	pct bases	   num bases

mapped:          	 83.3600% 	     8336 	 83.3600% 	      841936
unambiguous:     	 76.8500% 	     7685 	 76.8500% 	      776185
ambiguous:       	  6.5100% 	      651 	  6.5100% 	       65751
low-Q discards:  	  0.7700% 	       77 	  0.7700% 	        7777

perfect best site:	 83.3600% 	     8336 	 83.3600% 	      841936
semiperfect site:	 83.3600% 	     8336 	 83.3600% 	      841936

Match Rate:      	      NA 	       NA 	100.0000% 	      841936
Error Rate:      	  0.0000% 	        0 	  0.0000% 	           0
Sub Rate:        	  0.0000% 	        0 	  0.0000% 	           0
Del Rate:        	  0.0000% 	        0 	  0.0000% 	           0
Ins Rate:        	  0.0000% 	        0 	  0.0000% 	           0
N Rate:          	  0.0000% 	        0 	  0.0000% 	           0

Reads:                               	10000
Mapped reads:                        	9235
Mapped bases:                        	941970
Ref scaffolds:                       	17
Ref bases:                           	12157105

Percent mapped:                      	92.350
Percent proper pairs:                	0.000
Average coverage:                    	0.077
Average coverage with deletions:     	0.077
Standard deviation:                    	0.539
Percent scaffolds with any coverage: 	100.00
Percent of reference bases covered:  	4.89

Total time:     	5.346 seconds.
calulating flagstat...
Sorting and indexing bam
[bam_sort_core] merging from 0 files and 6 in-memory blocks...
Counting mapped reads...
java -ea -Xmx109367m -Xms109367m -cp /usr/local/opt/bbmap-38.96-1/current/ align2.BBMap build=1 overwrite=true fastareadlen=500 ref=input_2/ref.fasta threads=6 in=input_1//test2.fastq.gz out=output/test2.fastq.gz.temp.bam semiperfectmode=t maxindel=16000 minid=0.76 ambiguous=all requirecorrectstrand=f rpkm=output/test2.fastq.gz_rpkm.tsv covstats=output/test2.fastq.gz_covstats.tsv
Executing align2.BBMap [build=1, overwrite=true, fastareadlen=500, ref=input_2/ref.fasta, threads=6, in=input_1//test2.fastq.gz, out=output/test2.fastq.gz.temp.bam, semiperfectmode=t, maxindel=16000, minid=0.76, ambiguous=all, requirecorrectstrand=f, rpkm=output/test2.fastq.gz_rpkm.tsv, covstats=output/test2.fastq.gz_covstats.tsv]
Version 38.96

Set threads to 6
Retaining all best sites for ambiguous mappings.
NOTE:	Ignoring reference file because it already appears to have been processed.
NOTE:	If you wish to regenerate the index, please manually delete ref/genome/1/summary.txt
Set genome to 1

Loaded Reference:	0.107 seconds.
Loading index for chunk 1-1, build 1
Generated Index:	0.745 seconds.
Analyzed Index:   	3.119 seconds.
Found samtools 1.15
Started output stream:	0.060 seconds.
Cleared Memory:    	0.210 seconds.
Processing reads in single-ended mode.
Started read stream.
Started 6 mapping threads.
Detecting finished threads: 0, 1, 2, 3, 4, 5

   ------------------   Results   ------------------   

Genome:                	1
Key Length:            	13
Max Indel:             	0
Minimum Score Ratio:  	0.45
Mapping Mode:         	semiperfect
Reads Used:           	10000	(1010000 bases)

Mapping:          	0.476 seconds.
Reads/sec:       	21003.82
kBases/sec:      	2121.39


Read 1 data:      	pct reads	num reads 	pct bases	   num bases

mapped:          	 83.3600% 	     8336 	 83.3600% 	      841936
unambiguous:     	 76.8500% 	     7685 	 76.8500% 	      776185
ambiguous:       	  6.5100% 	      651 	  6.5100% 	       65751
low-Q discards:  	  0.7700% 	       77 	  0.7700% 	        7777

perfect best site:	 83.3600% 	     8336 	 83.3600% 	      841936
semiperfect site:	 83.3600% 	     8336 	 83.3600% 	      841936

Match Rate:      	      NA 	       NA 	100.0000% 	      841936
Error Rate:      	  0.0000% 	        0 	  0.0000% 	           0
Sub Rate:        	  0.0000% 	        0 	  0.0000% 	           0
Del Rate:        	  0.0000% 	        0 	  0.0000% 	           0
Ins Rate:        	  0.0000% 	        0 	  0.0000% 	           0
N Rate:          	  0.0000% 	        0 	  0.0000% 	           0

Reads:                               	10000
Mapped reads:                        	9235
Mapped bases:                        	941970
Ref scaffolds:                       	17
Ref bases:                           	12157105

Percent mapped:                      	92.350
Percent proper pairs:                	0.000
Average coverage:                    	0.077
Average coverage with deletions:     	0.077
Standard deviation:                    	0.539
Percent scaffolds with any coverage: 	100.00
Percent of reference bases covered:  	4.89

Total time:     	5.368 seconds.
calulating flagstat...
Sorting and indexing bam
[bam_sort_core] merging from 0 files and 6 in-memory blocks...
Counting mapped reads...
java -ea -Xmx109370m -Xms109370m -cp /usr/local/opt/bbmap-38.96-1/current/ align2.BBMap build=1 overwrite=true fastareadlen=500 ref=input_2/ref.fasta threads=6 in=input_1//test.fa out=output/test.fa.temp.bam semiperfectmode=t maxindel=16000 minid=0.76 ambiguous=all requirecorrectstrand=f rpkm=output/test.fa_rpkm.tsv covstats=output/test.fa_covstats.tsv
Executing align2.BBMap [build=1, overwrite=true, fastareadlen=500, ref=input_2/ref.fasta, threads=6, in=input_1//test.fa, out=output/test.fa.temp.bam, semiperfectmode=t, maxindel=16000, minid=0.76, ambiguous=all, requirecorrectstrand=f, rpkm=output/test.fa_rpkm.tsv, covstats=output/test.fa_covstats.tsv]
Version 38.96

Set threads to 6
Retaining all best sites for ambiguous mappings.
NOTE:	Ignoring reference file because it already appears to have been processed.
NOTE:	If you wish to regenerate the index, please manually delete ref/genome/1/summary.txt
Set genome to 1

Loaded Reference:	0.112 seconds.
Loading index for chunk 1-1, build 1
Generated Index:	0.772 seconds.
Analyzed Index:   	3.085 seconds.
Found samtools 1.15
Started output stream:	0.065 seconds.
Cleared Memory:    	0.185 seconds.
Processing reads in single-ended mode.
Started read stream.
Started 6 mapping threads.
Detecting finished threads: 0, 1, 2, 3, 4, 5

   ------------------   Results   ------------------   

Genome:                	1
Key Length:            	13
Max Indel:             	0
Minimum Score Ratio:  	0.45
Mapping Mode:         	semiperfect
Reads Used:           	10000	(1010000 bases)

Mapping:          	0.464 seconds.
Reads/sec:       	21569.59
kBases/sec:      	2178.53


Read 1 data:      	pct reads	num reads 	pct bases	   num bases

mapped:          	 83.3600% 	     8336 	 83.3600% 	      841936
unambiguous:     	 76.8500% 	     7685 	 76.8500% 	      776185
ambiguous:       	  6.5100% 	      651 	  6.5100% 	       65751
low-Q discards:  	  0.7700% 	       77 	  0.7700% 	        7777

perfect best site:	 83.3600% 	     8336 	 83.3600% 	      841936
semiperfect site:	 83.3600% 	     8336 	 83.3600% 	      841936

Match Rate:      	      NA 	       NA 	100.0000% 	      841936
Error Rate:      	  0.0000% 	        0 	  0.0000% 	           0
Sub Rate:        	  0.0000% 	        0 	  0.0000% 	           0
Del Rate:        	  0.0000% 	        0 	  0.0000% 	           0
Ins Rate:        	  0.0000% 	        0 	  0.0000% 	           0
N Rate:          	  0.0000% 	        0 	  0.0000% 	           0

Reads:                               	10000
Mapped reads:                        	9235
Mapped bases:                        	941970
Ref scaffolds:                       	17
Ref bases:                           	12157105

Percent mapped:                      	92.350
Percent proper pairs:                	0.000
Average coverage:                    	0.077
Average coverage with deletions:     	0.077
Standard deviation:                    	0.539
Percent scaffolds with any coverage: 	100.00
Percent of reference bases covered:  	4.89

Total time:     	5.352 seconds.
calulating flagstat...
Sorting and indexing bam
[bam_sort_core] merging from 0 files and 6 in-memory blocks...
Counting mapped reads...
java -ea -Xmx109363m -Xms109363m -cp /usr/local/opt/bbmap-38.96-1/current/ align2.BBMap build=1 overwrite=true fastareadlen=500 ref=input_2/ref.fasta threads=6 in1=input_1//SRR1363434_10k_1.fastq in2=input_1//SRR1363434_10k_2.fastq out=output/SRR1363434_10k_1.fastq.temp.bam semiperfectmode=t maxindel=16000 minid=0.76 ambiguous=all requirecorrectstrand=f rpkm=output/SRR1363434_10k_1.fastq_rpkm.tsv covstats=output/SRR1363434_10k_1.fastq_covstats.tsv
Executing align2.BBMap [build=1, overwrite=true, fastareadlen=500, ref=input_2/ref.fasta, threads=6, in1=input_1//SRR1363434_10k_1.fastq, in2=input_1//SRR1363434_10k_2.fastq, out=output/SRR1363434_10k_1.fastq.temp.bam, semiperfectmode=t, maxindel=16000, minid=0.76, ambiguous=all, requirecorrectstrand=f, rpkm=output/SRR1363434_10k_1.fastq_rpkm.tsv, covstats=output/SRR1363434_10k_1.fastq_covstats.tsv]
Version 38.96

Set threads to 6
Retaining all best sites for ambiguous mappings.
NOTE:	Ignoring reference file because it already appears to have been processed.
NOTE:	If you wish to regenerate the index, please manually delete ref/genome/1/summary.txt
Set genome to 1

Loaded Reference:	0.116 seconds.
Loading index for chunk 1-1, build 1
Generated Index:	0.753 seconds.
Analyzed Index:   	3.097 seconds.
Found samtools 1.15
Started output stream:	0.051 seconds.
Cleared Memory:    	0.189 seconds.
Processing reads in paired-ended mode.
Started read stream.
Started 6 mapping threads.
Detecting finished threads: 0, 1, 2, 3, 4, 5

   ------------------   Results   ------------------   

Genome:                	1
Key Length:            	13
Max Indel:             	0
Minimum Score Ratio:  	0.45
Mapping Mode:         	semiperfect
Reads Used:           	20000	(2020000 bases)

Mapping:          	0.626 seconds.
Reads/sec:       	31961.35
kBases/sec:      	3228.10


Pairing data:   	pct pairs	num pairs 	pct bases	   num bases

mated pairs:     	 68.2500% 	     6825 	 68.2500% 	     1378650
bad pairs:       	  0.1700% 	       17 	  0.1700% 	        3434
insert size avg: 	  266.09


Read 1 data:      	pct reads	num reads 	pct bases	   num bases

mapped:          	 83.6900% 	     8369 	 83.6900% 	      845269
unambiguous:     	 78.1300% 	     7813 	 78.1300% 	      789113
ambiguous:       	  5.5600% 	      556 	  5.5600% 	       56156
low-Q discards:  	  0.7700% 	       77 	  0.7700% 	        7777

perfect best site:	 83.6900% 	     8369 	 83.6900% 	      845269
semiperfect site:	 83.6900% 	     8369 	 83.6900% 	      845269
rescued:         	  0.3300% 	       33

Match Rate:      	      NA 	       NA 	100.0000% 	      845269
Error Rate:      	  0.0000% 	        0 	  0.0000% 	           0
Sub Rate:        	  0.0000% 	        0 	  0.0000% 	           0
Del Rate:        	  0.0000% 	        0 	  0.0000% 	           0
Ins Rate:        	  0.0000% 	        0 	  0.0000% 	           0
N Rate:          	  0.0000% 	        0 	  0.0000% 	           0


Read 2 data:      	pct reads	num reads 	pct bases	   num bases

mapped:          	 78.7800% 	     7878 	 78.7800% 	      795678
unambiguous:     	 73.5900% 	     7359 	 73.5900% 	      743259
ambiguous:       	  5.1900% 	      519 	  5.1900% 	       52419
low-Q discards:  	  0.0900% 	        9 	  0.0900% 	         909

perfect best site:	 78.7800% 	     7878 	 78.7800% 	      795678
semiperfect site:	 78.7800% 	     7878 	 78.7800% 	      795678
rescued:         	  0.3200% 	       32

Match Rate:      	      NA 	       NA 	100.0000% 	      795678
Error Rate:      	  0.0000% 	        0 	  0.0000% 	           0
Sub Rate:        	  0.0000% 	        0 	  0.0000% 	           0
Del Rate:        	  0.0000% 	        0 	  0.0000% 	           0
Ins Rate:        	  0.0000% 	        0 	  0.0000% 	           0
N Rate:          	  0.0000% 	        0 	  0.0000% 	           0

Reads:                               	20000
Mapped reads:                        	18247
Mapped bases:                        	1861194
Ref scaffolds:                       	17
Ref bases:                           	12157105

Percent mapped:                      	91.235
Percent proper pairs:                	76.935
Average coverage:                    	0.153
Average coverage with deletions:     	0.152
Standard deviation:                    	0.922
Percent scaffolds with any coverage: 	100.00
Percent of reference bases covered:  	8.51

Total time:     	5.575 seconds.
calulating flagstat...
Sorting and indexing bam
[bam_sort_core] merging from 0 files and 6 in-memory blocks...
Counting mapped reads...
++ date
+ echo completion at Fri May 27 17:17:08 JST 2022
completion at Fri May 27 17:17:08 JST 2022
++ date +%s
+ time_fin=1653639428
++ echo 'scale=2; (1653639428 - 1653639397)/60'
++ bc
+ echo -e 'Total running time is .51 min'
Total running time is .51 min
+ echo 'Run completed!'
Run completed!
+ post_processing
+ '[' 1 = 1 ']'
+ echo 0
+ exit
PID: 235726