An organelle genome assembly toolkit for HiFi reads. By including the genome file as input, a FASTA file is generated in which incomplete organelle genomes are removed and complete organelle genomes are added.
@cbba8101-681a-4320-9d61-c3555dc46ca7 qs:f:25.3335 st:Z:2025-03-05T09:33:25.314+00:00 RG:Z:9a437f06beab108e7b38c9f080a4b387fa2444d6_dna_r10.4.1_e8.2_400bps_sup@v5.0.0
CTATCATCCATGTTACAAACTATGCGAACGTCAAAAGGTCTTACAACCGAACAAGCTACAAAACTACTAACATACAATATTCAGAATGACAACTTATCAAAAGAACGCAAAGAATTCCTAATGAAAAAAGCAATATGGATATTCTATACAAATGCAAAGGTTGATACACACAATTTCACCATGATGAAATCAATTGTAAATGAAAAAAATCCTGTATGCAATTGTATGGGATACTTTAGTCCAGCACAAGGAAGTAACAGAGAAGTAGGAAACAGAACACATTTTGCATATTCAGAGCTGAAAAAAATTAATTCCACCATATGTCGGGGAGCAAGAGTAGCACTTGACAGAAACATCTGGGATAACATAGGCCTTTATAATGGCGCAATGGGGACTGTAATTGATATCCGTTTTGAACATAAAAAGAACCCTTTACAAGGAGACCTACCAAAATATGTAATTGTTGACTTTGACGAATATAAAGGACCACCTTGGAATGAATCAAATCCGTCCTACCTACCAATTCCACCATGTACAATACGATGCCGTAATGGATGCTGTACTTTCACAAAAATCCCTTTGACACTTTCTTGGGCAAGAACAGCACATAAATTTCAAGGTTCCAATGTTGGAAGTACATATCCAATCAAAGCAATGGTATTTGACCCTGGACAAACTGGTGTAGAAGGAAACAACCCAGGCTTTACATACGTTGGTTTAAGTAGAGTTTCCTCACTGGGACAAGGTAAAATTGAAAAATCTGCCCTTTACTTGACTGGTGAGAACCTCACCATGGAAAGATTCACTGATATGACATATCAAAGAACTAGAAAAAATGAAATGTACGTCAAAGTACAGGAGAAACAGATGGATACTACATCTACTACGACAAAAAACAAGAACAAACCTTGCAATCACACCAGACACCAAGACAAATTTAAAACGCTGGACACAGACAAATACTTATACTACTCTTCAACTAGAGCAAGCCATATTGTTCCATTCAGAACATTAAAACAACTCAGAGAAATATCATGATGGGTAAGATTCTATTTAGAATCTGACACATACACACTTCTATCTATTTGAGTGAAATTCTGTTCAGAAGTTCACACATAACTCTAATAACCTTTACTAAACTATTTACAATAATATACAACTTCTCATAAATTACTCTTTTACTTTTAACCTTTCAATCATTATTTCACAACTACACTTTCCTATCACGTGGTGACAACATATTCCCTAAGTACATGCATTTCAGACAATCCCCCACGCGCAGATTTACAATCTTAACATTCTTTCATAAATATAATGGTAGTCTCAACAAGAACTTCTGGTAAAAAAGCTTCAAAAAGATCCTCATCTTTTGTTCGGCAGCCCAAAAATGTCAGAACCAACAGATTTCAAAGGATACCATCCAGCCAACATAACCTCAACATGCCCCCCCAGTCAATAACAGAAGTGTTCCGGACTCAAATGAAAATAGGCTGGATATTGATTTAAAAAAAAAAAACTAATTTGTGATCACTGCAAGTTGGGATTTGATACAAAAAAAGAATTTTATTGCGCACACAACGACCTCACCGGCATGCAAGTATGTGCTGGGCTATTGTTATGGATGCAAGTCTACCTTCACCTCACAAAAAGCACTTACCCAACATTTAAATCACTCCAGTAAACAAGAATGTGGTGTCAAGCATATTTCCAATATGTTGGAATTTGCAACGACCTCCACTATGCCTATTGCCTTGGAGACAAACCAACAAACACAAATTTTGGTGAATCAGAAAGATTTGGCCCTTCACAACCTAAATAAAACCGCCACCAACAATAGACTCATAATGCAATCTATGCAATCCCAACTTCCTGGCACCTTTAATTATCCTGGTATTATGCAAAATTCTGGAGAATTTAACAATCATTATGATCACGACACCTCACAAGACAATTTTGATTTTTCTTCCCATGCACAATTTCCATCTTCTGTTGAAGATAACATTGACTTTATCAGCAATAACGGAGATGATGTCGAACATGAAATACCACGAGAAAACATAACTCCTCCATCCAATTCCTATTTATTCAAGCGAATGATTAGACAGAAAGAAAAAATTGAAGTAATACGGGATCAAGTCACTTGGAGCAACCAAATAACAGCAGCTCTTGAACTCGAACAGATTCTCCACAAGTCAGGAGCTCCATTGGGTCTCTTTTATAAGGTTATGGCCTGGGCTACAGAGAATCAGACATCCTTACCAGAACGAACGCTTCAACTTTCCCGCACACGCTTGTACAATACCTGTAGGGAGAAAATGTATGGCTGTGATCATGAGAAAAAACCGGAATTCAAGGTTTCTGCTAACCCACCTAAAATAGTGTCGGTCAAATTACCGTCCAAGAGAACTATCAATGTTGCCACATTCAGTTTTTTAGAACATCTGACCAGCATGCTATCCAGCAAAGAGCTTATGGCTGAAGAGAATCTAATATTTGAGAGGAAACCTAATGATCCTTTTCACGTACCGAGGGATAATGAAAGATATGGAGATGTCCATCAATGTAAATATTGGGATGACACTGTCGACATGCTCATCAATGATCCAACAACCGAAATTTTATGCCCCCTTATTCTTTATCTTGATGCCCTGGTTGTGGATGCATACGGAAATTTATCCCTTGAACCTGTAACATTTACGCTTGGCATTTTCAAGCGACTCCTTAGACATCATGGAAAAGCATGGAGAACTCTTGGATTCATAGAGGACCTGGATAGTCTATTCGGTGCCAACCATATCAAGCCATTGCAGAAAGCCAATGATTACCATGCAAT
>ptg000001l
TGAAGAATATGTTACCATGATACAGATCCCTAACTTTAGGACAGTATTTACTCTTGATGACACAAACATTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGACCATGTACCTGGGGTGACCCCCCGTGAAATTTTGATTTTCTTTAAGATTCTTGTAGAGCATCCCAAGGGCTACAAAATGTGCGTAGGTCCCAGCTCAAAACTCGCAATAGCCTTAGATATGGTCATTTTGCTACTACTAGTGGGAAGCTAGTAATTTTGACTTTTATTTCAGTTAAGGTCAAGTATCTCAAAACTGTACGTTGGTCCCGAGCTGAAACTTCAGCACAAGAAAAATGGCGATAAGGGCTAACTTTTGACACCCCAACGACTAATTTAGCTGCCATATTTTTTATTTTTTCAAAATCTTGCATTTTTTTATTTCTCTGATTACCACCACTTTCAATGAAATTTTGAAAAAAATATCATGATCGAATGTACATGATATATGATATACCTTCCTGGAATCATGACCCCACATTGGCAAGGTCATGAACGTGTAGATATTCACTATTCGTTACTATCTACTAGCTTTCAACTAGTGAACACTGTGCTACTACCACATACCACCACATTGACTTTTTTCAACCAAATTTTCATATCAACATGATCGAATGTACATGATATATGATATACCTTCCTGGAATGATGACCCCACATTGGCAAGGTTATGAACGTGTAGATATTCACTATTCGTTACTATCTACTAGCTTTCAACTAGTGAACACCATACTACTACCACATAACACCACATTGACTTTTTTCAACCAAATTTTCATATCAACATGATCAAATGTACATGATATATGATATACCTTCCTGGAATCATGACCCCACATTGGCAAGGTTATGAACGTGTAGATATTCACTATTCATTGCTATCTACTAGCTTTCAACTAGTGAACACTGTGCTACTACCACATACCACCACATTGACTTTTTTCAACCAAATTTTCATATCAACGTGATCGAATGTACATGATATATGATATACCTTCCTGGAATCATGACCCCACATTGGCAACGTCATGAACGTGTAGTTATTCACTATTCATTACTATCTACTAGCTTTCAACTAGTGAACACTATACTACTACCACATACCATCACATTGACTTTTTTCAACCAAATTTTCATATCAACGTGATCGAATGTACATGATATATGATATACCTTCCTGGAATCATGACCCCACATTGGCAAGGTCATGAACGTGTAGATATTCACTATTCGTTACTATCTACTAGCTTTCAACTAGTGAACACTGTGCTACTACCACATACCACCACATTGACTTTTTTCAACCAAATTTTCATATCAACATGATCGAATGTACATGATATATGATATTCTTGGCTGGAATCATGACCCCACATTGGCAAGGTTATGAACGTGTAGATATTCACTATTCGTTACTATCTACTAGCTTTCAACTAGTGAACACCATACTACTACCACATAACACCACATTGACTTTTTTCAACCAAATTTTCATATCAACGTGATCGAATGTACATGATATATGATATACCTTCCTGGAATCATGACCCCACATTGGCAAGGTTATGAACGTGTAGATATTCACTATTCATTGCTATCTACTAGCTTTCAACTAGTGAACACTGTGCTACTACCACATACCATCACATTGACTTTTTTCAACCAAATTTTCATATCAACGTGATCGAATGTACATGATATATGATATACCTTCCTGGAATCATGACCCCACATTGGCAAGGTTATGAACGTGTAGATATTCACTATTCATTGCTATCTACTAGCTTTCAACTAGTGAACACTATGCTACTACCACATACCATCACATTGACTTTTTTCAACCAAATTTTCATATCAACGTGATCGAATGTACATGATATATGATATACCTTCCTGGAATCATGACCCCACATTGGCAACGTCATGAACGTGTAGTTATTCACTATTCGTTACTATCTACTAGCTTTCAACTAGTGAACACTATACTACTACCACATACCACCACATTGACTTTTTTCAACCAAATTTTCATATCAACGTGATCGAATGTACATGATATATGATATACCTTCCTGGAATCATGACCCCACATTGGCAACGTCATGAACGTGTAGTTATTCACTATTCGTTACTATCTACTAGCTTTCAACTAGTGAACACTATACTACTACCACATGCCACCACATTGACTTTTTTCAACCAAATTTTCATATCAACGTGATCGAATGTACATGATATATGATATACCTTCCTGGAATCATGACCCCACATTGGCAACGTCATGAACGTGTAGATATTCACTATTCGTTACTATCTACTAGCTTTCAACTAGTGAACACTATACTACTACCACATGCCACCATATGGACTTTTTTCAACCAAATTTTCATATCAACGTGATTGAATGTACATGATATATGATATACCTTCCTGGAATCATGACCCCACATTGGCAACGTCATGAACGTGTAGATATTCACTATTCATTGCTATCTACTAGCTTTCAACTAGTAAACACTATGCTACTACCACATACCATCACATTGACCTTTTTCAACCAAAATTTTCATATCAACATGATCAAATGTACATGATATATGATATACCTTCCTGGAATCATGACCCCACATTGGCAAGGTCATGAATGTGTAGTTATTCACTATTCATTACTATCTACTAGCTTTCAACTAGCGAACACTATGCTACTACCACATAACACCACATTGACTTTTTTCTACCAAATTTGCATATCAACATGATCGAATGTACATGATATATGATATTCTTGGCTGGAATCATGACCCCACATTGGCAAGGTCATGAATGTGTAGTTATTCACTATTCATTACTATCTACTAGCTTTCAACTAGTGAACACTATGCTACTACCACATACCACCACATTGACTTTTTTCAACCAAATTTTCATATCAACATGATC
>ptg000001l
TGAAGAATATGTTACCATGATACAGATCCCTAACTTTAGGACAGTATTTACTCTTGATGACACAAACATTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGACCATGTACCTGGGGTGACCCCCCGTGAAATTTTGATTTTCTTTAAGATTCTTGTAGAGCATCCCAAGGGCTACAAAATGTGCGTAGGTCCCAGCTCAAAACTCGCAATAGCCTTAGATATGGTCATTTTGCTACTACTAGTGGGAAGCTAGTAATTTTGACTTTTATTTCAGTTAAGGTCAAGTATCTCAAAACTGTACGTTGGTCCCGAGCTGAAACTTCAGCACAAGAAAAATGGCGATAAGGGCTAACTTTTGACACCCCAACGACTAATTTAGCTGCCATATTTTTTATTTTTTCAAAATCTTGCATTTTTTTATTTCTCTGATTACCACCACTTTCAATGAAATTTTGAAAAAAATATCATGATCGAATGTACATGATATATGATATACCTTCCTGGAATCATGACCCCACATTGGCAAGGTCATGAACGTGTAGATATTCACTATTCGTTACTATCTACTAGCTTTCAACTAGTGAACACTGTGCTACTACCACATACCACCACATTGACTTTTTTCAACCAAATTTTCATATCAACATGATCGAATGTACATGATATATGATATACCTTCCTGGAATGATGACCCCACATTGGCAAGGTTATGAACGTGTAGATATTCACTATTCGTTACTATCTACTAGCTTTCAACTAGTGAACACCATACTACTACCACATAACACCACATTGACTTTTTTCAACCAAATTTTCATATCAACATGATCAAATGTACATGATATATGATATACCTTCCTGGAATCATGACCCCACATTGGCAAGGTTATGAACGTGTAGATATTCACTATTCATTGCTATCTACTAGCTTTCAACTAGTGAACACTGTGCTACTACCACATACCACCACATTGACTTTTTTCAACCAAATTTTCATATCAACGTGATCGAATGTACATGATATATGATATACCTTCCTGGAATCATGACCCCACATTGGCAACGTCATGAACGTGTAGTTATTCACTATTCATTACTATCTACTAGCTTTCAACTAGTGAACACTATACTACTACCACATACCATCACATTGACTTTTTTCAACCAAATTTTCATATCAACGTGATCGAATGTACATGATATATGATATACCTTCCTGGAATCATGACCCCACATTGGCAAGGTCATGAACGTGTAGATATTCACTATTCGTTACTATCTACTAGCTTTCAACTAGTGAACACTGTGCTACTACCACATACCACCACATTGACTTTTTTCAACCAAATTTTCATATCAACATGATCGAATGTACATGATATATGATATTCTTGGCTGGAATCATGACCCCACATTGGCAAGGTTATGAACGTGTAGATATTCACTATTCGTTACTATCTACTAGCTTTCAACTAGTGAACACCATACTACTACCACATAACACCACATTGACTTTTTTCAACCAAATTTTCATATCAACGTGATCGAATGTACATGATATATGATATACCTTCCTGGAATCATGACCCCACATTGGCAAGGTTATGAACGTGTAGATATTCACTATTCATTGCTATCTACTAGCTTTCAACTAGTGAACACTGTGCTACTACCACATACCATCACATTGACTTTTTTCAACCAAATTTTCATATCAACGTGATCGAATGTACATGATATATGATATACCTTCCTGGAATCATGACCCCACATTGGCAAGGTTATGAACGTGTAGATATTCACTATTCATTGCTATCTACTAGCTTTCAACTAGTGAACACTATGCTACTACCACATACCATCACATTGACTTTTTTCAACCAAATTTTCATATCAACGTGATCGAATGTACATGATATATGATATACCTTCCTGGAATCATGACCCCACATTGGCAACGTCATGAACGTGTAGTTATTCACTATTCGTTACTATCTACTAGCTTTCAACTAGTGAACACTATACTACTACCACATACCACCACATTGACTTTTTTCAACCAAATTTTCATATCAACGTGATCGAATGTACATGATATATGATATACCTTCCTGGAATCATGACCCCACATTGGCAACGTCATGAACGTGTAGTTATTCACTATTCGTTACTATCTACTAGCTTTCAACTAGTGAACACTATACTACTACCACATGCCACCACATTGACTTTTTTCAACCAAATTTTCATATCAACGTGATCGAATGTACATGATATATGATATACCTTCCTGGAATCATGACCCCACATTGGCAACGTCATGAACGTGTAGATATTCACTATTCGTTACTATCTACTAGCTTTCAACTAGTGAACACTATACTACTACCACATGCCACCATATGGACTTTTTTCAACCAAATTTTCATATCAACGTGATTGAATGTACATGATATATGATATACCTTCCTGGAATCATGACCCCACATTGGCAACGTCATGAACGTGTAGATATTCACTATTCATTGCTATCTACTAGCTTTCAACTAGTAAACACTATGCTACTACCACATACCATCACATTGACCTTTTTCAACCAAAATTTTCATATCAACATGATCAAATGTACATGATATATGATATACCTTCCTGGAATCATGACCCCACATTGGCAAGGTCATGAATGTGTAGTTATTCACTATTCATTACTATCTACTAGCTTTCAACTAGCGAACACTATGCTACTACCACATAACACCACATTGACTTTTTTCTACCAAATTTGCATATCAACATGATCGAATGTACATGATATATGATATTCTTGGCTGGAATCATGACCCCACATTGGCAAGGTCATGAATGTGTAGTTATTCACTATTCATTACTATCTACTAGCTTTCAACTAGTGAACACTATGCTACTACCACATACCACCACATTGACTTTTTTCAACCAAATTTTCATATCAACATGATC
assemble~oatk -c 8 -m 32 -f input_2/ont-ds-telo-contigs.bp.p_ctg.fa -m embryophyta_mito.fam -p embryophyta_pltd.fam input_1/
>ctg000001c length=117617 wlength=29044843.0 nv=4 circular=true path=u4-,u2-,u3+,u2+
TGAAAGCGGTACGCGAGCTGGGTTCAGAACGTCGTGAGACAGTTCGGTCCATATCCGGTG
TAGGCGTTAGAATATTGAGAGGAGCCTTCTTTAGTACGAGAGGACCGAGAAGGACATACC
TATGGTGTACCAGTTATCGTGCCAACGGTAAACGCTGGGTAGCTAAGTATGGAGTGGATA
ACCGCTGAAAGCATCTAAGTGGGAAGCCCACCTCAAGATGAGTATTCTCATCACGAAAGT
GAGTAAGGTCACGGTAAGACTAACCGTTTAATAGGCATCAAGTGTAAGTACAGTAATGTA
TGTGCTGAGATGTCCTAACAGACCGAGGACTTGAATTTTTAAAAGATATTTTTAAGAAAT
AGTTTCTTAAAAATATCACATATCTTTAAAGTAATTTTACTTTAAAGATTTTTGCTTTGG
TGTTTCTAGTGTACTGAACGGACCCACGCTGATCCATCTCGAACTCAGCTGTGAAACGTT
ATAAATCGGTGACAATACTTGGGGGGAGACCTCCTGGGAAGATAGCTCAATGCCAAAGTT
pp assemble~oatk -c 8 -m 32 -f input_2/ont-ds-telo-contigs.bp.p_ctg.fa input_1/ PID: 135793 /home/yoshitake.kazutoshi/files/m256y/pp-dev/yoshitake/PortablePipeline/PortablePipeline/scripts/pp 'assemble~oatk' -c 8 -m 32 -f input_2/ont-ds-telo-contigs.bp.p_ctg.fa input_1/ Checking the realpath of input files. 1 script: /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/PortablePipeline/PortablePipeline/scripts/assemble~oatk Containers: c2997108/oatk:1.0 centos:centos6 quay.io/biocontainers/minimap2:2.28--h577a1d6_4 quay.io/biocontainers/seqkit:2.6.1--h9ee0642_0 using docker ++ set -o pipefail + set -eux + set -o pipefail + input_hifi= + read i ++ find input_1// ++ egrep '[.]f((ast|)(q|a)|na|sa)(|[.]gz)$' + '[' '' = '' ']' + input_hifi=input_1//ch.fastq + read i + echo HiFi reads: input_1//ch.fastq HiFi reads: input_1//ch.fastq + optpltd= + '[' '' '!=' '' ']' /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/PortablePipeline/PortablePipeline/scripts/assemble~oatk: 行 42: t: 未割り当ての変数です PID: 138151 /home/yoshitake.kazutoshi/files/m256y/pp-dev/yoshitake/PortablePipeline/PortablePipeline/scripts/pp 'assemble~oatk' -c 8 -m 32 -f input_2/ont-ds-telo-contigs.bp.p_ctg.fa input_1/ Checking the realpath of input files. 1 script: /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/PortablePipeline/PortablePipeline/scripts/assemble~oatk Containers: c2997108/oatk:1.0 centos:centos6 quay.io/biocontainers/minimap2:2.28--h577a1d6_4 quay.io/biocontainers/seqkit:2.6.1--h9ee0642_0 using docker ++ set -o pipefail + set -eux + set -o pipefail + input_hifi= + read i ++ find input_1// ++ egrep '[.]f((ast|)(q|a)|na|sa)(|[.]gz)$' + '[' '' = '' ']' + input_hifi=input_1//ch.fastq + read i + echo HiFi reads: input_1//ch.fastq HiFi reads: input_1//ch.fastq + optpltd= + '[' '' '!=' '' ']' /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/PortablePipeline/PortablePipeline/scripts/assemble~oatk: 行 42: t: 未割り当ての変数です PID: 139644 /home/yoshitake.kazutoshi/files/m256y/pp-dev/yoshitake/PortablePipeline/PortablePipeline/scripts/pp 'assemble~oatk' -c 8 -m 32 -f input_2/ont-ds-telo-contigs.bp.p_ctg.fa -t dikarya_mito.fam input_1/ Checking the realpath of input files. 1 script: /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/PortablePipeline/PortablePipeline/scripts/assemble~oatk Containers: c2997108/oatk:1.0 centos:centos6 quay.io/biocontainers/minimap2:2.28--h577a1d6_4 quay.io/biocontainers/seqkit:2.6.1--h9ee0642_0 using docker ++ set -o pipefail + set -eux + set -o pipefail + input_hifi= + read i ++ find input_1// ++ egrep '[.]f((ast|)(q|a)|na|sa)(|[.]gz)$' + '[' '' = '' ']' + input_hifi=input_1//ch.fastq + read i + echo HiFi reads: input_1//ch.fastq HiFi reads: input_1//ch.fastq + optpltd= + '[' '' '!=' '' ']' /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/PortablePipeline/PortablePipeline/scripts/assemble~oatk: 行 42: t: 未割り当ての変数です PID: 141589 /home/yoshitake.kazutoshi/files/m256y/pp-dev/yoshitake/PortablePipeline/PortablePipeline/scripts/pp 'assemble~oatk' -c 8 -m 32 -f input_2/ont-ds-telo-contigs.bp.p_ctg.fa input_1/ Checking the realpath of input files. 1 script: /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/PortablePipeline/PortablePipeline/scripts/assemble~oatk Containers: c2997108/oatk:1.0 centos:centos6 quay.io/biocontainers/minimap2:2.28--h577a1d6_4 quay.io/biocontainers/seqkit:2.6.1--h9ee0642_0 using docker ++ set -o pipefail + set -eux + set -o pipefail + input_hifi= + read i ++ find input_1// ++ egrep '[.]f((ast|)(q|a)|na|sa)(|[.]gz)$' + '[' '' = '' ']' + input_hifi=input_1//ch.fastq + read i + echo HiFi reads: input_1//ch.fastq HiFi reads: input_1//ch.fastq + optpltd= + '[' '' '!=' '' ']' + FUNC_RUN_DOCKER c2997108/oatk:1.0 oatk -o oatk.asm -t 8 -t /usr/local/oatkdb/dikarya_mito.fam input_1//ch.fastq + PP_RUN_IMAGE=c2997108/oatk:1.0 + shift + PP_RUN_DOCKER_CMD=("${@}") ++ date +%Y%m%d_%H%M%S_%3N + PPDOCNAME=pp20250515_014514_230_8018 + echo pp20250515_014514_230_8018 ++ id -u ++ id -g + docker run --name pp20250515_014514_230_8018 -v /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk:/suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk -w /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk -v /suikou/files/m256y/yoshitake.kazutoshi:/suikou/files/m256y/yoshitake.kazutoshi -u 2007:600 -i --rm c2997108/oatk:1.0 oatk -o oatk.asm -t 8 -t /usr/local/oatkdb/dikarya_mito.fam input_1//ch.fastq [E::main] provide at least one HMM profile database (-m and/or -p) PID: 142694 /home/yoshitake.kazutoshi/files/m256y/pp-dev/yoshitake/PortablePipeline/PortablePipeline/scripts/pp 'assemble~oatk' -c 8 -m 32 -f input_2/ont-ds-telo-contigs.bp.p_ctg.fa input_1/ Checking the realpath of input files. 1 script: /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/PortablePipeline/PortablePipeline/scripts/assemble~oatk Containers: c2997108/oatk:1.0 centos:centos6 quay.io/biocontainers/minimap2:2.28--h577a1d6_4 quay.io/biocontainers/seqkit:2.6.1--h9ee0642_0 using docker ++ set -o pipefail + set -eux + set -o pipefail + input_hifi= + read i ++ find input_1// ++ egrep '[.]f((ast|)(q|a)|na|sa)(|[.]gz)$' + '[' '' = '' ']' + input_hifi=input_1//ch.fastq + read i + echo HiFi reads: input_1//ch.fastq HiFi reads: input_1//ch.fastq + optpltd= + '[' '' '!=' '' ']' + FUNC_RUN_DOCKER c2997108/oatk:1.0 oatk -o oatk.asm -t 8 -m /usr/local/oatkdb/dikarya_mito.fam input_1//ch.fastq + PP_RUN_IMAGE=c2997108/oatk:1.0 + shift + PP_RUN_DOCKER_CMD=("${@}") ++ date +%Y%m%d_%H%M%S_%3N + PPDOCNAME=pp20250515_014601_053_11569 + echo pp20250515_014601_053_11569 ++ id -u ++ id -g + docker run --name pp20250515_014601_053_11569 -v /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk:/suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk -w /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk -v /suikou/files/m256y/yoshitake.kazutoshi:/suikou/files/m256y/yoshitake.kazutoshi -u 2007:600 -i --rm c2997108/oatk:1.0 oatk -o oatk.asm -t 8 -m /usr/local/oatkdb/dikarya_mito.fam input_1//ch.fastq [M::syncasm] collected syncmers from 100000 target sequence(s) [M::sr_db_stat] number syncmers collected: 612053 [M::sr_db_stat] number syncmers per read: 6.121 [M::sr_db_stat] average kmer space: -619.665 [M::sr_db_stat] number uniqe smer: 203238; singletons: 125029 (61.519%) [M::sr_db_stat] average smer count: 3.012 [M::sr_db_stat] smer peak_hom: 22; peak_het: -1 [M::sr_db_stat] number uniqe kmer: 491420; singletons: 458727 (93.347%) [M::sr_db_stat] average kmer count: 1.245 [M::sr_db_stat] kmer peak_hom: 15; peak_het: 11 [M::find_error_syncmers] error syncmer candidates: num = 491361, max_c = 83 [M::read_error_correction] Error Correction Summary Results [M::read_error_correction] total number of error blocks : 2275 [M::read_error_correction] - uncorrected : 2157 [M::read_error_correction] - corrected : 97 [M::read_error_correction] - ambiguous seqs : 0 [M::read_error_correction] - ambiguous path : 0 [M::sr_db_stat] number syncmers collected: 617240 [M::sr_db_stat] number syncmers per read: 6.172 [M::sr_db_stat] average kmer space: -619.567 [M::sr_db_stat] number uniqe smer: 203213; singletons: 125017 (61.520%) [M::sr_db_stat] average smer count: 3.037 [M::sr_db_stat] smer peak_hom: 22; peak_het: -1 [M::sr_db_stat] number uniqe kmer: 491367; singletons: 458685 (93.349%) [M::sr_db_stat] average kmer count: 1.256 [M::sr_db_stat] kmer peak_hom: 15; peak_het: 11 [M::syncasm] make syncmer graph [M::syncasm] syncmer graph stats [M::scg_stat] number unitigs : 178 [M::scg_stat] number syncmers : 178 [M::scg_stat] number arcs : 314 [M::syncasm] syncmer graph unitigging [M::syncasm] syncmer graph stats after unitigging [M::scg_stat] number unitigs : 35 [M::scg_stat] number syncmers : 178 [M::scg_stat] number arcs : 28 [M::syncasm] syncmer graph cleanup [M::syncasm] assembly graph unzipping [M::scg_read_alignment] 65248 mappable reads, 429 mapped (429 unique mapping) [M::scg_read_alignment] 65248 mappable reads, 85 mapped (85 unique mapping) [M::scg_read_alignment] 65248 mappable reads, 429 mapped (429 unique mapping) [M::scg_read_alignment] 65248 mappable reads, 429 mapped (429 unique mapping) [M::syncasm] syncmer graph stats after final processing [M::scg_stat] number unitigs : 18 [M::scg_stat] number syncmers : 113 [M::scg_stat] number arcs : 28 [M::annot_worker_pipeline] 18 sequences (86446 bp) loaded in 1 batch [W::gfa_parse_L] the coverage of arc 'u7-' -> 'u7-' is zero [W::gfa_parse_L] the coverage of arc 'u7+' -> 'u7+' is zero [W::gfa_parse_L] the coverage of arc 'u13-' -> 'u13-' is zero [W::gfa_parse_L] the coverage of arc 'u13+' -> 'u13+' is zero [M::main] Version: 1.0 [M::main] CMD: oatk -o oatk.asm -t 8 -m /usr/local/oatkdb/dikarya_mito.fam input_1//ch.fastq [M::main] Real time: 57.733 sec; CPU: 18.331 sec; Peak RSS: 1.129 GB /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/PortablePipeline/PortablePipeline/scripts/assemble~oatk: 行 71: 予期しないトークン `(' 周辺に構文エラーがあります PID: 144467 /home/yoshitake.kazutoshi/files/m256y/pp-dev/yoshitake/PortablePipeline/PortablePipeline/scripts/pp 'assemble~oatk' -c 8 -m 32 -f input_2/ont-ds-telo-contigs.bp.p_ctg.fa input_1/ Checking the realpath of input files. 1 script: /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/PortablePipeline/PortablePipeline/scripts/assemble~oatk Containers: c2997108/oatk:1.0 centos:centos6 quay.io/biocontainers/minimap2:2.28--h577a1d6_4 quay.io/biocontainers/seqkit:2.6.1--h9ee0642_0 using docker ++ set -o pipefail + set -eux + set -o pipefail + input_hifi= + read i ++ find input_1// ++ egrep '[.]f((ast|)(q|a)|na|sa)(|[.]gz)$' + '[' '' = '' ']' + input_hifi=input_1//ch.fastq + read i + echo HiFi reads: input_1//ch.fastq HiFi reads: input_1//ch.fastq + optpltd= + '[' '' '!=' '' ']' + FUNC_RUN_DOCKER c2997108/oatk:1.0 oatk -o oatk.asm -t 8 -m /usr/local/oatkdb/dikarya_mito.fam input_1//ch.fastq + PP_RUN_IMAGE=c2997108/oatk:1.0 + shift + PP_RUN_DOCKER_CMD=("${@}") ++ date +%Y%m%d_%H%M%S_%3N + PPDOCNAME=pp20250515_014742_214_29201 + echo pp20250515_014742_214_29201 ++ id -u ++ id -g + docker run --name pp20250515_014742_214_29201 -v /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk:/suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk -w /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk -v /suikou/files/m256y/yoshitake.kazutoshi:/suikou/files/m256y/yoshitake.kazutoshi -u 2007:600 -i --rm c2997108/oatk:1.0 oatk -o oatk.asm -t 8 -m /usr/local/oatkdb/dikarya_mito.fam input_1//ch.fastq [M::syncasm] collected syncmers from 100000 target sequence(s) [M::sr_db_stat] number syncmers collected: 612053 [M::sr_db_stat] number syncmers per read: 6.121 [M::sr_db_stat] average kmer space: -619.665 [M::sr_db_stat] number uniqe smer: 203238; singletons: 125029 (61.519%) [M::sr_db_stat] average smer count: 3.012 [M::sr_db_stat] smer peak_hom: 22; peak_het: -1 [M::sr_db_stat] number uniqe kmer: 491420; singletons: 458727 (93.347%) [M::sr_db_stat] average kmer count: 1.245 [M::sr_db_stat] kmer peak_hom: 15; peak_het: 11 [M::find_error_syncmers] error syncmer candidates: num = 491361, max_c = 83 [M::read_error_correction] Error Correction Summary Results [M::read_error_correction] total number of error blocks : 2275 [M::read_error_correction] - uncorrected : 2157 [M::read_error_correction] - corrected : 97 [M::read_error_correction] - ambiguous seqs : 0 [M::read_error_correction] - ambiguous path : 0 [M::sr_db_stat] number syncmers collected: 617240 [M::sr_db_stat] number syncmers per read: 6.172 [M::sr_db_stat] average kmer space: -619.567 [M::sr_db_stat] number uniqe smer: 203213; singletons: 125017 (61.520%) [M::sr_db_stat] average smer count: 3.037 [M::sr_db_stat] smer peak_hom: 22; peak_het: -1 [M::sr_db_stat] number uniqe kmer: 491367; singletons: 458685 (93.349%) [M::sr_db_stat] average kmer count: 1.256 [M::sr_db_stat] kmer peak_hom: 15; peak_het: 11 [M::syncasm] make syncmer graph [M::syncasm] syncmer graph stats [M::scg_stat] number unitigs : 178 [M::scg_stat] number syncmers : 178 [M::scg_stat] number arcs : 314 [M::syncasm] syncmer graph unitigging [M::syncasm] syncmer graph stats after unitigging [M::scg_stat] number unitigs : 35 [M::scg_stat] number syncmers : 178 [M::scg_stat] number arcs : 28 [M::syncasm] syncmer graph cleanup [M::syncasm] assembly graph unzipping [M::scg_read_alignment] 65248 mappable reads, 429 mapped (429 unique mapping) [M::scg_read_alignment] 65248 mappable reads, 85 mapped (85 unique mapping) [M::scg_read_alignment] 65248 mappable reads, 429 mapped (429 unique mapping) [M::scg_read_alignment] 65248 mappable reads, 429 mapped (429 unique mapping) [M::syncasm] syncmer graph stats after final processing [M::scg_stat] number unitigs : 18 [M::scg_stat] number syncmers : 113 [M::scg_stat] number arcs : 28 [M::annot_worker_pipeline] 18 sequences (86446 bp) loaded in 1 batch [W::gfa_parse_L] the coverage of arc 'u7-' -> 'u7-' is zero [W::gfa_parse_L] the coverage of arc 'u7+' -> 'u7+' is zero [W::gfa_parse_L] the coverage of arc 'u13-' -> 'u13-' is zero [W::gfa_parse_L] the coverage of arc 'u13+' -> 'u13+' is zero [M::main] Version: 1.0 [M::main] CMD: oatk -o oatk.asm -t 8 -m /usr/local/oatkdb/dikarya_mito.fam input_1//ch.fastq [M::main] Real time: 58.334 sec; CPU: 18.447 sec; Peak RSS: 1.130 GB + '[' input_2/ont-ds-telo-contigs.bp.p_ctg.fa '!=' '' ']' ++ wc -l ++ grep '[.]gz$' ++ echo input_2/ont-ds-telo-contigs.bp.p_ctg.fa ++ true + '[' 0 = 1 ']' + sed 's/\r//' + awk '{if($0~"^>"){sub(/ .*/,"",$0)}; print $0}' input_2/ont-ds-telo-contigs.bp.p_ctg.fa + input_2=input_2/ont-ds-telo-contigs.bp.p_ctg.fa.ref.fa + cat oatk.asm.mito.ctg.fasta + sed 's/\t/ /g' + FUNC_RUN_DOCKER quay.io/biocontainers/seqkit:2.6.1--h9ee0642_0 seqkit fx2tab + PP_RUN_IMAGE=quay.io/biocontainers/seqkit:2.6.1--h9ee0642_0 + shift + PP_RUN_DOCKER_CMD=("${@}") + awk '-F\t' '{print ">mitochondrion_"$1"\n"$2}' ++ date +%Y%m%d_%H%M%S_%3N + PPDOCNAME=pp20250515_014842_370_15078 + echo pp20250515_014842_370_15078 ++ id -u ++ id -g + docker run --name pp20250515_014842_370_15078 -v /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk:/suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk -w /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk -v /suikou/files/m256y/yoshitake.kazutoshi:/suikou/files/m256y/yoshitake.kazutoshi -u 2007:600 -i --rm quay.io/biocontainers/seqkit:2.6.1--h9ee0642_0 seqkit fx2tab + '[' -e oatk.asm.pltd.ctg.fasta ']' + FUNC_RUN_DOCKER quay.io/biocontainers/minimap2:2.28--h577a1d6_4 minimap2 -x asm10 plastid.fa input_2/ont-ds-telo-contigs.bp.p_ctg.fa.ref.fa -t 8 + PP_RUN_IMAGE=quay.io/biocontainers/minimap2:2.28--h577a1d6_4 + shift + PP_RUN_DOCKER_CMD=("${@}") ++ date +%Y%m%d_%H%M%S_%3N + PPDOCNAME=pp20250515_014843_231_29122 + echo pp20250515_014843_231_29122 ++ id -u ++ id -g + docker run --name pp20250515_014843_231_29122 -v /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk:/suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk -w /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk -v /suikou/files/m256y/yoshitake.kazutoshi:/suikou/files/m256y/yoshitake.kazutoshi -u 2007:600 -i --rm quay.io/biocontainers/minimap2:2.28--h577a1d6_4 minimap2 -x asm10 plastid.fa input_2/ont-ds-telo-contigs.bp.p_ctg.fa.ref.fa -t 8 [M::mm_idx_gen::0.001*62.89] collected minimizers [M::mm_idx_gen::0.002*25.79] sorted minimizers [M::main::0.002*25.70] loaded/built the index for 0 target sequence(s) [M::mm_mapopt_update::0.002*25.51] mid_occ = 500 [M::mm_idx_stat] kmer size: 19; skip: 19; is_hpc: 0; #seq: 0 [M::mm_idx_stat::0.002*25.19] distinct minimizers: 0 (-nan% are singletons); average occurrences: -nan; average spacing: -nan; total length: 0 [M::worker_pipeline::1.552*4.18] mapped 370 sequences [M::main] Version: 2.28-r1209 [M::main] CMD: minimap2 -x asm10 -t 8 plastid.fa input_2/ont-ds-telo-contigs.bp.p_ctg.fa.ref.fa [M::main] Real time: 1.554 sec; CPU: 6.488 sec; Peak RSS: 0.878 GB + cat plastid.fa.minimap2 + awk '-F\t' '{len[$1]=$2; n[$1]++; hit1[$1][n[$1]]=$3; hit2[$1][n[$1]]=$4} END{for(i in n){PROCINFO["sorted_in"]="@val_num_asc"; oldstart=-1; oldend=-1; alignlen=0; for(j in hit1[i]){if(hit1[i][j]0.5){contami=1}else{contami=0}; print i"\t"len[i]"\t"alignlen"\t"percent"\t"contami}}' + sort -k1,1 + FUNC_RUN_DOCKER quay.io/biocontainers/seqkit:2.6.1--h9ee0642_0 seqkit fx2tab input_2/ont-ds-telo-contigs.bp.p_ctg.fa.ref.fa + PP_RUN_IMAGE=quay.io/biocontainers/seqkit:2.6.1--h9ee0642_0 + shift + PP_RUN_DOCKER_CMD=("${@}") + awk '-F\t' 'FILENAME==ARGV[1]&&$5==1{contami[$1]=1} FILENAME==ARGV[2]&&contami[$1]!=1{print ">"$1"\n"$2}' plastid.fa.minimap2.contami /dev/stdin ++ date +%Y%m%d_%H%M%S_%3N ++ basename input_2/ont-ds-telo-contigs.bp.p_ctg.fa.ref.fa + PPDOCNAME=pp20250515_014845_387_27876 + echo pp20250515_014845_387_27876 ++ id -u ++ id -g + docker run --name pp20250515_014845_387_27876 -v /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk:/suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk -w /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk -v /suikou/files/m256y/yoshitake.kazutoshi:/suikou/files/m256y/yoshitake.kazutoshi -u 2007:600 -i --rm quay.io/biocontainers/seqkit:2.6.1--h9ee0642_0 seqkit fx2tab input_2/ont-ds-telo-contigs.bp.p_ctg.fa.ref.fa ++ basename input_2/ont-ds-telo-contigs.bp.p_ctg.fa.ref.fa + cat ont-ds-telo-contigs.bp.p_ctg.fa.ref.fa.rem.fa plastid.fa ++ basename input_2/ont-ds-telo-contigs.bp.p_ctg.fa.ref.fa + post_processing + '[' 1 = 1 ']' + rm -f /home/yoshitake.kazutoshi/files/m256y/pp-dev/yoshitake/test/assemble~oatk/pp-singularity-flag + '[' '' = y ']' + echo 0 + exit PID: 150147 /home/yoshitake.kazutoshi/files/m256y/pp-dev/yoshitake/PortablePipeline/PortablePipeline/scripts/pp 'assemble~oatk' -c 8 -m 32 -f input_2/ont-ds-telo-contigs.bp.p_ctg.fa -p embryophyta_pltd.fam input_1/ Checking the realpath of input files. 1 script: /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/PortablePipeline/PortablePipeline/scripts/assemble~oatk Containers: c2997108/oatk:1.0 centos:centos6 quay.io/biocontainers/minimap2:2.28--h577a1d6_4 quay.io/biocontainers/seqkit:2.6.1--h9ee0642_0 using docker ++ set -o pipefail + set -eux + set -o pipefail + input_hifi= + read i ++ find input_1// ++ egrep '[.]f((ast|)(q|a)|na|sa)(|[.]gz)$' + '[' '' = '' ']' + input_hifi=input_1//ch.fastq + read i + echo HiFi reads: input_1//ch.fastq HiFi reads: input_1//ch.fastq + optpltd= + '[' embryophyta_pltd.fam '!=' '' ']' /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/PortablePipeline/PortablePipeline/scripts/assemble~oatk: 行 41: p: 未割り当ての変数です PID: 150566 /home/yoshitake.kazutoshi/files/m256y/pp-dev/yoshitake/PortablePipeline/PortablePipeline/scripts/pp 'assemble~oatk' -c 8 -m 32 -f input_2/ont-ds-telo-contigs.bp.p_ctg.fa -p embryophyta_pltd.fam input_1/ Checking the realpath of input files. 1 script: /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/PortablePipeline/PortablePipeline/scripts/assemble~oatk Containers: c2997108/oatk:1.0 centos:centos6 quay.io/biocontainers/minimap2:2.28--h577a1d6_4 quay.io/biocontainers/seqkit:2.6.1--h9ee0642_0 using docker ++ set -o pipefail + set -eux + set -o pipefail + input_hifi= + read i ++ find input_1// ++ egrep '[.]f((ast|)(q|a)|na|sa)(|[.]gz)$' + '[' '' = '' ']' + input_hifi=input_1//ch.fastq + read i + echo HiFi reads: input_1//ch.fastq HiFi reads: input_1//ch.fastq + optpltd= + '[' embryophyta_pltd.fam '!=' '' ']' + optpltd='-p /usr/local/oatkdb/embryophyta_pltd.fam' + FUNC_RUN_DOCKER c2997108/oatk:1.0 oatk -o oatk.asm -t 8 -m /usr/local/oatkdb/dikarya_mito.fam -p /usr/local/oatkdb/embryophyta_pltd.fam input_1//ch.fastq + PP_RUN_IMAGE=c2997108/oatk:1.0 + shift + PP_RUN_DOCKER_CMD=("${@}") ++ date +%Y%m%d_%H%M%S_%3N + PPDOCNAME=pp20250515_015352_789_3244 + echo pp20250515_015352_789_3244 ++ id -u ++ id -g + docker run --name pp20250515_015352_789_3244 -v /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk:/suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk -w /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk -v /suikou/files/m256y/yoshitake.kazutoshi:/suikou/files/m256y/yoshitake.kazutoshi -u 2007:600 -i --rm c2997108/oatk:1.0 oatk -o oatk.asm -t 8 -m /usr/local/oatkdb/dikarya_mito.fam -p /usr/local/oatkdb/embryophyta_pltd.fam input_1//ch.fastq [M::syncasm] collected syncmers from 250000 target sequence(s) [M::sr_db_stat] number syncmers collected: 2118029 [M::sr_db_stat] number syncmers per read: 8.472 [M::sr_db_stat] average kmer space: -631.569 [M::sr_db_stat] number uniqe smer: 422779; singletons: 247137 (58.455%) [M::sr_db_stat] average smer count: 5.010 [M::sr_db_stat] smer peak_hom: 33; peak_het: 30 [M::sr_db_stat] number uniqe kmer: 1483824; singletons: 1329719 (89.614%) [M::sr_db_stat] average kmer count: 1.427 [M::sr_db_stat] kmer peak_hom: 14; peak_het: -1 [M::find_error_syncmers] error syncmer candidates: num = 1483557, max_c = 109 [M::read_error_correction] Error Correction Summary Results [M::read_error_correction] total number of error blocks : 17934 [M::read_error_correction] - uncorrected : 4546 [M::read_error_correction] - corrected : 13228 [M::read_error_correction] - ambiguous seqs : 2 [M::read_error_correction] - ambiguous path : 1 [M::sr_db_stat] number syncmers collected: 2143337 [M::sr_db_stat] number syncmers per read: 8.573 [M::sr_db_stat] average kmer space: -632.918 [M::sr_db_stat] number uniqe smer: 421912; singletons: 246459 (58.415%) [M::sr_db_stat] average smer count: 5.080 [M::sr_db_stat] smer peak_hom: 33; peak_het: 30 [M::sr_db_stat] number uniqe kmer: 1464186; singletons: 1310879 (89.530%) [M::sr_db_stat] average kmer count: 1.464 [M::sr_db_stat] kmer peak_hom: 17; peak_het: 14 [M::syncasm] make syncmer graph [M::syncasm] syncmer graph stats [M::scg_stat] number unitigs : 382 [M::scg_stat] number syncmers : 382 [M::scg_stat] number arcs : 682 [M::syncasm] syncmer graph unitigging [M::syncasm] syncmer graph stats after unitigging [M::scg_stat] number unitigs : 101 [M::scg_stat] number syncmers : 382 [M::scg_stat] number arcs : 120 [M::syncasm] syncmer graph cleanup [M::syncasm] assembly graph unzipping [M::scg_read_alignment] 179303 mappable reads, 4729 mapped (4729 unique mapping) [M::scg_read_alignment] 179303 mappable reads, 742 mapped (742 unique mapping) [M::scg_read_alignment] 179303 mappable reads, 4729 mapped (4729 unique mapping) [M::scg_read_alignment] 179303 mappable reads, 4729 mapped (4729 unique mapping) [M::syncasm] syncmer graph stats after final processing [M::scg_stat] number unitigs : 48 [M::scg_stat] number syncmers : 243 [M::scg_stat] number arcs : 102 [M::annot_worker_pipeline] 48 sequences (179328 bp) loaded in 2 batches [M::annot_worker_pipeline] 48 sequences (179328 bp) loaded in 2 batches [W::gfa_parse_L] the coverage of arc 'u10-' -> 'u10-' is zero [W::gfa_parse_L] the coverage of arc 'u10+' -> 'u10+' is zero [W::gfa_parse_L] the coverage of arc 'u11-' -> 'u11-' is zero [W::gfa_parse_L] the coverage of arc 'u11+' -> 'u11+' is zero [W::gfa_parse_L] the coverage of arc 'u12-' -> 'u12-' is zero [W::gfa_parse_L] the coverage of arc 'u12+' -> 'u12+' is zero [W::gfa_parse_L] the coverage of arc 'u14-' -> 'u14-' is zero [W::gfa_parse_L] the coverage of arc 'u14+' -> 'u14+' is zero [W::gfa_parse_L] the coverage of arc 'u22-' -> 'u22-' is zero [W::gfa_parse_L] the coverage of arc 'u22+' -> 'u22+' is zero [W::gfa_parse_L] the coverage of arc 'u24-' -> 'u24-' is zero [W::gfa_parse_L] the coverage of arc 'u24+' -> 'u24+' is zero [W::gfa_parse_L] the coverage of arc 'u25-' -> 'u25-' is zero [W::gfa_parse_L] the coverage of arc 'u25+' -> 'u25+' is zero [W::gfa_parse_L] the coverage of arc 'u26-' -> 'u26-' is zero [W::gfa_parse_L] the coverage of arc 'u26+' -> 'u26+' is zero [W::gfa_parse_L] the coverage of arc 'u27-' -> 'u27-' is zero [W::gfa_parse_L] the coverage of arc 'u27+' -> 'u27+' is zero [W::gfa_parse_L] the coverage of arc 'u29-' -> 'u29-' is zero [W::gfa_parse_L] the coverage of arc 'u29+' -> 'u29+' is zero [W::gfa_parse_L] the coverage of arc 'u30-' -> 'u30-' is zero [W::gfa_parse_L] the coverage of arc 'u30+' -> 'u30+' is zero [W::gfa_parse_L] the coverage of arc 'u31-' -> 'u31-' is zero [W::gfa_parse_L] the coverage of arc 'u31+' -> 'u31+' is zero [W::gfa_parse_L] the coverage of arc 'u36-' -> 'u36-' is zero [W::gfa_parse_L] the coverage of arc 'u36+' -> 'u36+' is zero [W::gfa_parse_L] the coverage of arc 'u44-' -> 'u45+' is zero [W::gfa_parse_L] the coverage of arc 'u45-' -> 'u44+' is zero [M::main] Version: 1.0 [M::main] CMD: oatk -o oatk.asm -t 8 -m /usr/local/oatkdb/dikarya_mito.fam -p /usr/local/oatkdb/embryophyta_pltd.fam input_1//ch.fastq [M::main] Real time: 169.628 sec; CPU: 63.910 sec; Peak RSS: 3.360 GB + '[' input_2/ont-ds-telo-contigs.bp.p_ctg.fa '!=' '' ']' ++ echo input_2/ont-ds-telo-contigs.bp.p_ctg.fa ++ grep '[.]gz$' ++ wc -l ++ true + '[' 0 = 1 ']' + awk '{if($0~"^>"){sub(/ .*/,"",$0)}; print $0}' input_2/ont-ds-telo-contigs.bp.p_ctg.fa + sed 's/\r//' + input_2=input_2/ont-ds-telo-contigs.bp.p_ctg.fa.ref.fa + cat oatk.asm.mito.ctg.fasta + sed 's/\t/ /g' + FUNC_RUN_DOCKER quay.io/biocontainers/seqkit:2.6.1--h9ee0642_0 seqkit fx2tab + awk '-F\t' '{print ">mitochondrion_"$1"\n"$2}' + PP_RUN_IMAGE=quay.io/biocontainers/seqkit:2.6.1--h9ee0642_0 + shift + PP_RUN_DOCKER_CMD=("${@}") ++ date +%Y%m%d_%H%M%S_%3N + PPDOCNAME=pp20250515_015644_373_20942 + echo pp20250515_015644_373_20942 ++ id -u ++ id -g + docker run --name pp20250515_015644_373_20942 -v /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk:/suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk -w /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk -v /suikou/files/m256y/yoshitake.kazutoshi:/suikou/files/m256y/yoshitake.kazutoshi -u 2007:600 -i --rm quay.io/biocontainers/seqkit:2.6.1--h9ee0642_0 seqkit fx2tab + '[' -e oatk.asm.pltd.ctg.fasta ']' + cat oatk.asm.pltd.ctg.fasta + sed 's/\t/ /g' + FUNC_RUN_DOCKER quay.io/biocontainers/seqkit:2.6.1--h9ee0642_0 seqkit fx2tab + awk '-F\t' '{print ">chloroplast_"$1"\n"$2}' + PP_RUN_IMAGE=quay.io/biocontainers/seqkit:2.6.1--h9ee0642_0 + shift + PP_RUN_DOCKER_CMD=("${@}") ++ date +%Y%m%d_%H%M%S_%3N + PPDOCNAME=pp20250515_015645_267_17336 + echo pp20250515_015645_267_17336 ++ id -u ++ id -g + docker run --name pp20250515_015645_267_17336 -v /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk:/suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk -w /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk -v /suikou/files/m256y/yoshitake.kazutoshi:/suikou/files/m256y/yoshitake.kazutoshi -u 2007:600 -i --rm quay.io/biocontainers/seqkit:2.6.1--h9ee0642_0 seqkit fx2tab + FUNC_RUN_DOCKER quay.io/biocontainers/minimap2:2.28--h577a1d6_4 minimap2 -x asm10 plastid.fa input_2/ont-ds-telo-contigs.bp.p_ctg.fa.ref.fa -t 8 + PP_RUN_IMAGE=quay.io/biocontainers/minimap2:2.28--h577a1d6_4 + shift + PP_RUN_DOCKER_CMD=("${@}") ++ date +%Y%m%d_%H%M%S_%3N + PPDOCNAME=pp20250515_015645_962_16416 + echo pp20250515_015645_962_16416 ++ id -u ++ id -g + docker run --name pp20250515_015645_962_16416 -v /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk:/suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk -w /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk -v /suikou/files/m256y/yoshitake.kazutoshi:/suikou/files/m256y/yoshitake.kazutoshi -u 2007:600 -i --rm quay.io/biocontainers/minimap2:2.28--h577a1d6_4 minimap2 -x asm10 plastid.fa input_2/ont-ds-telo-contigs.bp.p_ctg.fa.ref.fa -t 8 [M::mm_idx_gen::0.008*8.52] collected minimizers [M::mm_idx_gen::0.011*7.65] sorted minimizers [M::main::0.011*7.64] loaded/built the index for 1 target sequence(s) [M::mm_mapopt_update::0.012*6.98] mid_occ = 50 [M::mm_idx_stat] kmer size: 19; skip: 19; is_hpc: 0; #seq: 1 [M::mm_idx_stat::0.014*6.47] distinct minimizers: 10978 (93.10% are singletons); average occurrences: 1.069; average spacing: 10.020; total length: 117617 [M::worker_pipeline::1.632*4.74] mapped 370 sequences [M::main] Version: 2.28-r1209 [M::main] CMD: minimap2 -x asm10 -t 8 plastid.fa input_2/ont-ds-telo-contigs.bp.p_ctg.fa.ref.fa [M::main] Real time: 1.637 sec; CPU: 7.741 sec; Peak RSS: 0.887 GB + cat plastid.fa.minimap2 + awk '-F\t' '{len[$1]=$2; n[$1]++; hit1[$1][n[$1]]=$3; hit2[$1][n[$1]]=$4} END{for(i in n){PROCINFO["sorted_in"]="@val_num_asc"; oldstart=-1; oldend=-1; alignlen=0; for(j in hit1[i]){if(hit1[i][j] 0.5){contami=1}else{contami=0}; print i"\t"len[i]"\t"alignlen"\t"percent"\t"contami}}' + sort -k1,1 + FUNC_RUN_DOCKER quay.io/biocontainers/seqkit:2.6.1--h9ee0642_0 seqkit fx2tab input_2/ont-ds-telo-contigs.bp.p_ctg.fa.ref.fa + PP_RUN_IMAGE=quay.io/biocontainers/seqkit:2.6.1--h9ee0642_0 + shift + PP_RUN_DOCKER_CMD=("${@}") + awk '-F\t' 'FILENAME==ARGV[1]&&$5==1{contami[$1]=1} FILENAME==ARGV[2]&&contami[$1]!=1{print ">"$1"\n"$2}' plastid.fa.minimap2.contami /dev/stdin ++ date +%Y%m%d_%H%M%S_%3N ++ basename input_2/ont-ds-telo-contigs.bp.p_ctg.fa.ref.fa + PPDOCNAME=pp20250515_015648_224_1356 + echo pp20250515_015648_224_1356 ++ id -u ++ id -g + docker run --name pp20250515_015648_224_1356 -v /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk:/suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk -w /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk -v /suikou/files/m256y/yoshitake.kazutoshi:/suikou/files/m256y/yoshitake.kazutoshi -u 2007:600 -i --rm quay.io/biocontainers/seqkit:2.6.1--h9ee0642_0 seqkit fx2tab input_2/ont-ds-telo-contigs.bp.p_ctg.fa.ref.fa ++ basename input_2/ont-ds-telo-contigs.bp.p_ctg.fa.ref.fa + cat ont-ds-telo-contigs.bp.p_ctg.fa.ref.fa.rem.fa plastid.fa ++ basename input_2/ont-ds-telo-contigs.bp.p_ctg.fa.ref.fa + post_processing + '[' 1 = 1 ']' + rm -f /home/yoshitake.kazutoshi/files/m256y/pp-dev/yoshitake/test/assemble~oatk/pp-singularity-flag + '[' '' = y ']' + echo 0 + exit PID: 160142 /home/yoshitake.kazutoshi/files/m256y/pp-dev/yoshitake/PortablePipeline/PortablePipeline/scripts/pp 'assemble~oatk' -c 8 -m 32 -f input_2/ont-ds-telo-contigs.bp.p_ctg.fa -m embryophyta_mito.fam -p embryophyta_pltd.fam input_1/ Checking the realpath of input files. 1 script: /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/PortablePipeline/PortablePipeline/scripts/assemble~oatk Containers: c2997108/oatk:1.0 centos:centos6 quay.io/biocontainers/minimap2:2.28--h577a1d6_4 quay.io/biocontainers/seqkit:2.6.1--h9ee0642_0 using docker ++ set -o pipefail + set -eux + set -o pipefail + input_hifi= + read i ++ find input_1// ++ egrep '[.]f((ast|)(q|a)|na|sa)(|[.]gz)$' + '[' '' = '' ']' + input_hifi=input_1//ch.fastq + read i + echo HiFi reads: input_1//ch.fastq HiFi reads: input_1//ch.fastq + optpltd= + '[' embryophyta_pltd.fam '!=' '' ']' + optpltd='-p /usr/local/oatkdb/embryophyta_pltd.fam' + FUNC_RUN_DOCKER c2997108/oatk:1.0 oatk -o oatk.asm -t 8 -m /usr/local/oatkdb/dikarya_mito.fam -p /usr/local/oatkdb/embryophyta_pltd.fam input_1//ch.fastq + PP_RUN_IMAGE=c2997108/oatk:1.0 + shift + PP_RUN_DOCKER_CMD=("${@}") ++ date +%Y%m%d_%H%M%S_%3N + PPDOCNAME=pp20250515_020338_844_11001 + echo pp20250515_020338_844_11001 ++ id -u ++ id -g + docker run --name pp20250515_020338_844_11001 -v /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk:/suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk -w /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk -v /suikou/files/m256y/yoshitake.kazutoshi:/suikou/files/m256y/yoshitake.kazutoshi -u 2007:600 -i --rm c2997108/oatk:1.0 oatk -o oatk.asm -t 8 -m /usr/local/oatkdb/dikarya_mito.fam -p /usr/local/oatkdb/embryophyta_pltd.fam input_1//ch.fastq [M::syncasm] collected syncmers from 250000 target sequence(s) [M::sr_db_stat] number syncmers collected: 2118029 [M::sr_db_stat] number syncmers per read: 8.472 [M::sr_db_stat] average kmer space: -631.569 [M::sr_db_stat] number uniqe smer: 422779; singletons: 247137 (58.455%) [M::sr_db_stat] average smer count: 5.010 [M::sr_db_stat] smer peak_hom: 33; peak_het: 30 [M::sr_db_stat] number uniqe kmer: 1483824; singletons: 1329719 (89.614%) [M::sr_db_stat] average kmer count: 1.427 [M::sr_db_stat] kmer peak_hom: 14; peak_het: -1 [M::find_error_syncmers] error syncmer candidates: num = 1483557, max_c = 109 [M::read_error_correction] Error Correction Summary Results [M::read_error_correction] total number of error blocks : 17934 [M::read_error_correction] - uncorrected : 4546 [M::read_error_correction] - corrected : 13228 [M::read_error_correction] - ambiguous seqs : 2 [M::read_error_correction] - ambiguous path : 1 [M::sr_db_stat] number syncmers collected: 2143337 [M::sr_db_stat] number syncmers per read: 8.573 [M::sr_db_stat] average kmer space: -632.918 [M::sr_db_stat] number uniqe smer: 421912; singletons: 246459 (58.415%) [M::sr_db_stat] average smer count: 5.080 [M::sr_db_stat] smer peak_hom: 33; peak_het: 30 [M::sr_db_stat] number uniqe kmer: 1464186; singletons: 1310879 (89.530%) [M::sr_db_stat] average kmer count: 1.464 [M::sr_db_stat] kmer peak_hom: 17; peak_het: 14 [M::syncasm] make syncmer graph [M::syncasm] syncmer graph stats [M::scg_stat] number unitigs : 382 [M::scg_stat] number syncmers : 382 [M::scg_stat] number arcs : 682 [M::syncasm] syncmer graph unitigging [M::syncasm] syncmer graph stats after unitigging [M::scg_stat] number unitigs : 101 [M::scg_stat] number syncmers : 382 [M::scg_stat] number arcs : 120 [M::syncasm] syncmer graph cleanup [M::syncasm] assembly graph unzipping [M::scg_read_alignment] 179303 mappable reads, 4729 mapped (4729 unique mapping) [M::scg_read_alignment] 179303 mappable reads, 742 mapped (742 unique mapping) [M::scg_read_alignment] 179303 mappable reads, 4729 mapped (4729 unique mapping) [M::scg_read_alignment] 179303 mappable reads, 4729 mapped (4729 unique mapping) [M::syncasm] syncmer graph stats after final processing [M::scg_stat] number unitigs : 48 [M::scg_stat] number syncmers : 243 [M::scg_stat] number arcs : 102 [M::annot_worker_pipeline] 48 sequences (179328 bp) loaded in 2 batches [M::annot_worker_pipeline] 48 sequences (179328 bp) loaded in 2 batches [W::gfa_parse_L] the coverage of arc 'u10-' -> 'u10-' is zero [W::gfa_parse_L] the coverage of arc 'u10+' -> 'u10+' is zero [W::gfa_parse_L] the coverage of arc 'u11-' -> 'u11-' is zero [W::gfa_parse_L] the coverage of arc 'u11+' -> 'u11+' is zero [W::gfa_parse_L] the coverage of arc 'u12-' -> 'u12-' is zero [W::gfa_parse_L] the coverage of arc 'u12+' -> 'u12+' is zero [W::gfa_parse_L] the coverage of arc 'u14-' -> 'u14-' is zero [W::gfa_parse_L] the coverage of arc 'u14+' -> 'u14+' is zero [W::gfa_parse_L] the coverage of arc 'u22-' -> 'u22-' is zero [W::gfa_parse_L] the coverage of arc 'u22+' -> 'u22+' is zero [W::gfa_parse_L] the coverage of arc 'u24-' -> 'u24-' is zero [W::gfa_parse_L] the coverage of arc 'u24+' -> 'u24+' is zero [W::gfa_parse_L] the coverage of arc 'u25-' -> 'u25-' is zero [W::gfa_parse_L] the coverage of arc 'u25+' -> 'u25+' is zero [W::gfa_parse_L] the coverage of arc 'u26-' -> 'u26-' is zero [W::gfa_parse_L] the coverage of arc 'u26+' -> 'u26+' is zero [W::gfa_parse_L] the coverage of arc 'u27-' -> 'u27-' is zero [W::gfa_parse_L] the coverage of arc 'u27+' -> 'u27+' is zero [W::gfa_parse_L] the coverage of arc 'u29-' -> 'u29-' is zero [W::gfa_parse_L] the coverage of arc 'u29+' -> 'u29+' is zero [W::gfa_parse_L] the coverage of arc 'u30-' -> 'u30-' is zero [W::gfa_parse_L] the coverage of arc 'u30+' -> 'u30+' is zero [W::gfa_parse_L] the coverage of arc 'u31-' -> 'u31-' is zero [W::gfa_parse_L] the coverage of arc 'u31+' -> 'u31+' is zero [W::gfa_parse_L] the coverage of arc 'u36-' -> 'u36-' is zero [W::gfa_parse_L] the coverage of arc 'u36+' -> 'u36+' is zero [W::gfa_parse_L] the coverage of arc 'u44-' -> 'u45+' is zero [W::gfa_parse_L] the coverage of arc 'u45-' -> 'u44+' is zero [M::main] Version: 1.0 [M::main] CMD: oatk -o oatk.asm -t 8 -m /usr/local/oatkdb/dikarya_mito.fam -p /usr/local/oatkdb/embryophyta_pltd.fam input_1//ch.fastq [M::main] Real time: 169.158 sec; CPU: 63.158 sec; Peak RSS: 3.342 GB + '[' input_2/ont-ds-telo-contigs.bp.p_ctg.fa '!=' '' ']' ++ echo input_2/ont-ds-telo-contigs.bp.p_ctg.fa ++ grep '[.]gz$' ++ wc -l ++ true + '[' 0 = 1 ']' + awk '{if($0~"^>"){sub(/ .*/,"",$0)}; print $0}' input_2/ont-ds-telo-contigs.bp.p_ctg.fa + sed 's/\r//' + input_2=input_2/ont-ds-telo-contigs.bp.p_ctg.fa.ref.fa + cat oatk.asm.mito.ctg.fasta + sed 's/\t/ /g' + FUNC_RUN_DOCKER quay.io/biocontainers/seqkit:2.6.1--h9ee0642_0 seqkit fx2tab + awk '-F\t' '{print ">mitochondrion_"$1"\n"$2}' + PP_RUN_IMAGE=quay.io/biocontainers/seqkit:2.6.1--h9ee0642_0 + shift + PP_RUN_DOCKER_CMD=("${@}") ++ date +%Y%m%d_%H%M%S_%3N + PPDOCNAME=pp20250515_020629_971_29321 + echo pp20250515_020629_971_29321 ++ id -u ++ id -g + docker run --name pp20250515_020629_971_29321 -v /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk:/suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk -w /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk -v /suikou/files/m256y/yoshitake.kazutoshi:/suikou/files/m256y/yoshitake.kazutoshi -u 2007:600 -i --rm quay.io/biocontainers/seqkit:2.6.1--h9ee0642_0 seqkit fx2tab + '[' -e oatk.asm.pltd.ctg.fasta ']' + cat oatk.asm.pltd.ctg.fasta + sed 's/\t/ /g' + FUNC_RUN_DOCKER quay.io/biocontainers/seqkit:2.6.1--h9ee0642_0 seqkit fx2tab + awk '-F\t' '{print ">chloroplast_"$1"\n"$2}' + PP_RUN_IMAGE=quay.io/biocontainers/seqkit:2.6.1--h9ee0642_0 + shift + PP_RUN_DOCKER_CMD=("${@}") ++ date +%Y%m%d_%H%M%S_%3N + PPDOCNAME=pp20250515_020630_838_18995 + echo pp20250515_020630_838_18995 ++ id -u ++ id -g + docker run --name pp20250515_020630_838_18995 -v /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk:/suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk -w /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk -v /suikou/files/m256y/yoshitake.kazutoshi:/suikou/files/m256y/yoshitake.kazutoshi -u 2007:600 -i --rm quay.io/biocontainers/seqkit:2.6.1--h9ee0642_0 seqkit fx2tab + FUNC_RUN_DOCKER quay.io/biocontainers/minimap2:2.28--h577a1d6_4 minimap2 -x asm10 plastid.fa input_2/ont-ds-telo-contigs.bp.p_ctg.fa.ref.fa -t 8 + PP_RUN_IMAGE=quay.io/biocontainers/minimap2:2.28--h577a1d6_4 + shift + PP_RUN_DOCKER_CMD=("${@}") ++ date +%Y%m%d_%H%M%S_%3N + PPDOCNAME=pp20250515_020631_492_14636 + echo pp20250515_020631_492_14636 ++ id -u ++ id -g + docker run --name pp20250515_020631_492_14636 -v /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk:/suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk -w /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk -v /suikou/files/m256y/yoshitake.kazutoshi:/suikou/files/m256y/yoshitake.kazutoshi -u 2007:600 -i --rm quay.io/biocontainers/minimap2:2.28--h577a1d6_4 minimap2 -x asm10 plastid.fa input_2/ont-ds-telo-contigs.bp.p_ctg.fa.ref.fa -t 8 [M::mm_idx_gen::0.013*5.20] collected minimizers [M::mm_idx_gen::0.016*5.29] sorted minimizers [M::main::0.016*5.28] loaded/built the index for 1 target sequence(s) [M::mm_mapopt_update::0.018*4.92] mid_occ = 50 [M::mm_idx_stat] kmer size: 19; skip: 19; is_hpc: 0; #seq: 1 [M::mm_idx_stat::0.019*4.66] distinct minimizers: 10978 (93.10% are singletons); average occurrences: 1.069; average spacing: 10.020; total length: 117617 [M::worker_pipeline::1.591*4.84] mapped 370 sequences [M::main] Version: 2.28-r1209 [M::main] CMD: minimap2 -x asm10 -t 8 plastid.fa input_2/ont-ds-telo-contigs.bp.p_ctg.fa.ref.fa [M::main] Real time: 1.594 sec; CPU: 7.706 sec; Peak RSS: 0.888 GB + cat plastid.fa.minimap2 + sort -k1,1 + awk '-F\t' '{len[$1]=$2; n[$1]++; hit1[$1][n[$1]]=$3; hit2[$1][n[$1]]=$4} END{for(i in n){PROCINFO["sorted_in"]="@val_num_asc"; oldstart=-1; oldend=-1; alignlen=0; for(j in hit1[i]){if(hit1[i][j] 0.5){contami=1}else{contami=0}; print i"\t"len[i]"\t"alignlen"\t"percent"\t"contami}}' + FUNC_RUN_DOCKER quay.io/biocontainers/seqkit:2.6.1--h9ee0642_0 seqkit fx2tab input_2/ont-ds-telo-contigs.bp.p_ctg.fa.ref.fa + PP_RUN_IMAGE=quay.io/biocontainers/seqkit:2.6.1--h9ee0642_0 + shift + PP_RUN_DOCKER_CMD=("${@}") + awk '-F\t' 'FILENAME==ARGV[1]&&$5==1{contami[$1]=1} FILENAME==ARGV[2]&&contami[$1]!=1{print ">"$1"\n"$2}' plastid.fa.minimap2.contami /dev/stdin ++ date +%Y%m%d_%H%M%S_%3N ++ basename input_2/ont-ds-telo-contigs.bp.p_ctg.fa.ref.fa + PPDOCNAME=pp20250515_020633_790_22922 + echo pp20250515_020633_790_22922 ++ id -u ++ id -g + docker run --name pp20250515_020633_790_22922 -v /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk:/suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk -w /suikou/files/m256y/yoshitake.kazutoshi/work/pp-dev/yoshitake/test/assemble~oatk -v /suikou/files/m256y/yoshitake.kazutoshi:/suikou/files/m256y/yoshitake.kazutoshi -u 2007:600 -i --rm quay.io/biocontainers/seqkit:2.6.1--h9ee0642_0 seqkit fx2tab input_2/ont-ds-telo-contigs.bp.p_ctg.fa.ref.fa ++ basename input_2/ont-ds-telo-contigs.bp.p_ctg.fa.ref.fa + cat ont-ds-telo-contigs.bp.p_ctg.fa.ref.fa.rem.fa plastid.fa ++ basename input_2/ont-ds-telo-contigs.bp.p_ctg.fa.ref.fa + post_processing + '[' 1 = 1 ']' + rm -f /home/yoshitake.kazutoshi/files/m256y/pp-dev/yoshitake/test/assemble~oatk/pp-singularity-flag + '[' '' = y ']' + echo 0 + exit