RNA-seq~SNPcall-bbmap-callvariants

BBMap SNP call pipeline from WGS or RNA-seq data

input_1:paired-end or single-end FASTQ(.gz) or FASTA(.gz) files

input_1/Le1-1-501-701_1.fastq.gz

input_1/Le1-1-501-701_2.fastq.gz

input_1/Le1-12-501-708_1.fastq.gz

input_1/Le1-12-501-708_2.fastq.gz

input_1/Le1-17-502-703_2.fastq.gz

input_1/Le1-13-502-701_2.fastq.gz

input_1/Le1-17-502-703_1.fastq.gz

input_1/Le1-13-502-701_1.fastq.gz

input_2:reference genome file

input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta

>h1tg000001l
ATCTTCAAACCAACTGCGCCCACACCCACTTTCATCATTTCTCCAGACGATAGGGCATTA
ATCATGGCACGGTTCACTGTAATTGAAAATCTTGTATCAGATGGTTTACTAGCATAAGTG
TGTGTTTAATTTTGCAATACGCTTTCCTCACATCTTTGTTCTTAGTGTTGAGGTTGCAGT
GCTCACCATACATCAATTCATAAGTGATTAGAAGAGACAGAGAACAAGGGGCAATAGCAA
AGCATTTGCTCACTTTGGCACCATTCGGACTGCACTCAATAGTTTATATGGTTTAATAAT
CATCCCTGCATATATCATGCAAGAACTCTTTGAATTTGTAATCACCGTGCATGCACACTT
TCGCCAAATTTCTATGGCAAGTCTGCATTGATTCCTTTTTGCTCAACGGATCACTAATTG
TCCTGTATAGTTAGAGCCCGTTCACAAACCTCGCACAGGCAAATCACCTGCAAAGGTCAA
CATCGTTTTCAACGTCAGCGGAGCAATGTTGAACTAAAATTAGCATACTCTAAAAGAATG

Command

RNA-seq~SNPcall-bbmap-callvariants -c 16 -m 128 input_1/ input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta

Output

output.vcf

##fileformat=VCFv4.2
##BBMapVersion=38.96
##ploidy=2
##rarity=1.00000
##minallelefraction=0.10000
##reads=703054
##pairedReads=703054
##properlyPairedReads=624842
##properPairRate=0.8888
##readLengthAvg=140.87

view all outputs

Log

pp RNA-seq~SNPcall-bbmap-callvariants -c 16 -m 128 input_1/ input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
Checking the realpath of input files.
0 input_1/
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-1-501-701_1.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-1-501-701_2.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-12-501-708_1.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-12-501-708_2.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-17-502-703_2.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-13-502-701_2.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-17-502-703_1.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-13-502-701_1.fastq.gz
0 input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
script: /yoshitake/PortablePipeline/PortablePipeline/scripts/RNA-seq~SNPcall-bbmap-callvariants "$scriptdir"/mapping-illumina~bbmap
broadinstitute/gatk:4.3.0.0 centos:centos6 quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1 quay.io/biocontainers/picard:2.18.27--0
using docker
+ set -o pipefail
++ date +%s
+ time0=1677603411
+ echo start at 1677603411
start at 1677603411
+ bash /yoshitake/PortablePipeline/PortablePipeline/scripts/mapping-illumina~bbmap -c 16 -m 128 -i '' -j 'maxindel=100000 maxsites2=10000' -b ON -o '' input_1/ input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
Checking the realpath of input files.
0 input_1/
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-1-501-701_1.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-1-501-701_2.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-12-501-708_1.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-12-501-708_2.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-17-502-703_2.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-13-502-701_2.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-17-502-703_1.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-13-502-701_1.fastq.gz
0 input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
broadinstitute/gatk:4.3.0.0 centos:centos6 quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1 quay.io/biocontainers/picard:2.18.27--0
using docker
+ set -o pipefail
+ exec
++ tee log.txt
+ LANG=C
+ threads=16
+ three=16
++ expr 16 / 2
+ threads2=8
++ expr 16 - 2
+ threads1=14
+ '[' 14 -lt 1 ']'
++ free -g
++ grep Mem
++ sed -e 's/Mem: *\([0-9]*\) .*/\1/'
+ memG=251
++ expr 251 '*' 3 / 4
+ memG3=188
+ echo '
#####SYSTEM ENVIRONMENT#####
  threads=16
  memory=251G
############################
'

#####SYSTEM ENVIRONMENT#####
  threads=16
  memory=251G
############################

++ date +%s
+ time0=1677603411
+ echo start at 1677603411
start at 1677603411
+ echo -e 'Checking paramter settings...\n'
Checking paramter settings...

+ indexing_param=k=13
+ mapping_param='maxindel=100000 maxsites2=10000'
+ out_files=
+ for i in '$opt_o'
+ out_files+=' rpkm=rpkm.tsv'
+ for i in '$opt_o'
+ out_files+=' covstats=covstats.tsv'
+ mapped_only_bam=ON
++ echo input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
++ grep '[.]gz$'
++ wc -l
++ true
+ '[' 0 = 1 ']'
+ ref=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
+ FUNC_RUN_DOCKER quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1 bbmap.sh threads=16 k=13 ref=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
+ PP_RUN_IMAGE=quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1
+ shift
+ PP_RUN_DOCKER_CMD=("${@}")
++ date +%Y%m%d_%H%M%S_%3N
+ PPDOCNAME=pp20230301_015651_639_11352
+ echo pp20230301_015651_639_11352
++ id -u
++ id -g
+ docker run --name pp20230301_015651_639_11352 -v /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants:/yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants -w /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1 bbmap.sh threads=16 k=13 ref=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
java -ea -Xmx109177m -Xms109177m -cp /usr/local/opt/bbmap-38.96-1/current/ align2.BBMap build=1 overwrite=true fastareadlen=500 threads=16 k=13 ref=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
Executing align2.BBMap [build=1, overwrite=true, fastareadlen=500, threads=16, k=13, ref=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta]
Version 38.96

Set threads to 16
No output file.
NOTE:	Ignoring reference file because it already appears to have been processed.
NOTE:	If you wish to regenerate the index, please manually delete ref/genome/1/summary.txt
Set genome to 1

Loaded Reference:	0.393 seconds.
Loading index for chunk 1-1, build 1
Generated Index:	1.168 seconds.
No reads to process; quitting.

Total time:     	1.686 seconds.
+ cat
+ pppair1=()
+ pppair2=()
+ ppsingle=()
+ IFS=
+ read i
++ find input_1//
++ egrep '(_R1.*|_1)[.]f((ast|)(q|a)|na|sa)(|[.]gz)$'
++ echo input_1//Le1-1-501-701_1.fastq.gz
++ egrep '_1[.]f((ast|)(q|a)|na|sa)(|[.]gz)$'
++ wc -l
+ '[' 1 = 1 ']'
++ echo input_1//Le1-1-501-701_1.fastq.gz
++ sed 's/_1[.]\(f\(\(ast\|\)\(q\|a\)\|na\|sa\)\(\|[.]gz\)\)$/_2.\1/'
+ temppair2=input_1//Le1-1-501-701_2.fastq.gz
+ '[' -e input_1//Le1-1-501-701_2.fastq.gz ']'
+ pppair1+=("$i")
+ pppair2+=("$temppair2")
+ IFS=
+ read i
++ echo input_1//Le1-12-501-708_1.fastq.gz
++ egrep '_1[.]f((ast|)(q|a)|na|sa)(|[.]gz)$'
++ wc -l
+ '[' 1 = 1 ']'
++ echo input_1//Le1-12-501-708_1.fastq.gz
++ sed 's/_1[.]\(f\(\(ast\|\)\(q\|a\)\|na\|sa\)\(\|[.]gz\)\)$/_2.\1/'
+ temppair2=input_1//Le1-12-501-708_2.fastq.gz
+ '[' -e input_1//Le1-12-501-708_2.fastq.gz ']'
+ pppair1+=("$i")
+ pppair2+=("$temppair2")
+ IFS=
+ read i
++ echo input_1//Le1-17-502-703_1.fastq.gz
++ egrep '_1[.]f((ast|)(q|a)|na|sa)(|[.]gz)$'
++ wc -l
+ '[' 1 = 1 ']'
++ echo input_1//Le1-17-502-703_1.fastq.gz
++ sed 's/_1[.]\(f\(\(ast\|\)\(q\|a\)\|na\|sa\)\(\|[.]gz\)\)$/_2.\1/'
+ temppair2=input_1//Le1-17-502-703_2.fastq.gz
+ '[' -e input_1//Le1-17-502-703_2.fastq.gz ']'
+ pppair1+=("$i")
+ pppair2+=("$temppair2")
+ IFS=
+ read i
++ echo input_1//Le1-13-502-701_1.fastq.gz
++ egrep '_1[.]f((ast|)(q|a)|na|sa)(|[.]gz)$'
++ wc -l
+ '[' 1 = 1 ']'
++ echo input_1//Le1-13-502-701_1.fastq.gz
++ sed 's/_1[.]\(f\(\(ast\|\)\(q\|a\)\|na\|sa\)\(\|[.]gz\)\)$/_2.\1/'
+ temppair2=input_1//Le1-13-502-701_2.fastq.gz
+ '[' -e input_1//Le1-13-502-701_2.fastq.gz ']'
+ pppair1+=("$i")
+ pppair2+=("$temppair2")
+ IFS=
+ read i
+ IFS=
+ read i
++ find input_1//
++ egrep '[.]f((ast|)(q|a)|na|sa)(|[.]gz)$'
+ ppinputcheck=0
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-1-501-701_1.fastq.gz = input_1//Le1-1-501-701_1.fastq.gz ']'
+ ppinputcheck=1
+ break
+ '[' 1 = 0 ']'
+ IFS=
+ read i
+ ppinputcheck=0
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-1-501-701_1.fastq.gz = input_1//Le1-1-501-701_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-12-501-708_1.fastq.gz = input_1//Le1-1-501-701_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-17-502-703_1.fastq.gz = input_1//Le1-1-501-701_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-13-502-701_1.fastq.gz = input_1//Le1-1-501-701_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-1-501-701_2.fastq.gz = input_1//Le1-1-501-701_2.fastq.gz ']'
+ ppinputcheck=1
+ break
+ '[' 1 = 0 ']'
+ IFS=
+ read i
+ ppinputcheck=0
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-1-501-701_1.fastq.gz = input_1//Le1-12-501-708_1.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-12-501-708_1.fastq.gz = input_1//Le1-12-501-708_1.fastq.gz ']'
+ ppinputcheck=1
+ break
+ '[' 1 = 0 ']'
+ IFS=
+ read i
+ ppinputcheck=0
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-1-501-701_1.fastq.gz = input_1//Le1-12-501-708_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-12-501-708_1.fastq.gz = input_1//Le1-12-501-708_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-17-502-703_1.fastq.gz = input_1//Le1-12-501-708_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-13-502-701_1.fastq.gz = input_1//Le1-12-501-708_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-1-501-701_2.fastq.gz = input_1//Le1-12-501-708_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-12-501-708_2.fastq.gz = input_1//Le1-12-501-708_2.fastq.gz ']'
+ ppinputcheck=1
+ break
+ '[' 1 = 0 ']'
+ IFS=
+ read i
+ ppinputcheck=0
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-1-501-701_1.fastq.gz = input_1//Le1-17-502-703_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-12-501-708_1.fastq.gz = input_1//Le1-17-502-703_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-17-502-703_1.fastq.gz = input_1//Le1-17-502-703_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-13-502-701_1.fastq.gz = input_1//Le1-17-502-703_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-1-501-701_2.fastq.gz = input_1//Le1-17-502-703_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-12-501-708_2.fastq.gz = input_1//Le1-17-502-703_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-17-502-703_2.fastq.gz = input_1//Le1-17-502-703_2.fastq.gz ']'
+ ppinputcheck=1
+ break
+ '[' 1 = 0 ']'
+ IFS=
+ read i
+ ppinputcheck=0
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-1-501-701_1.fastq.gz = input_1//Le1-13-502-701_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-12-501-708_1.fastq.gz = input_1//Le1-13-502-701_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-17-502-703_1.fastq.gz = input_1//Le1-13-502-701_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-13-502-701_1.fastq.gz = input_1//Le1-13-502-701_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-1-501-701_2.fastq.gz = input_1//Le1-13-502-701_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-12-501-708_2.fastq.gz = input_1//Le1-13-502-701_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-17-502-703_2.fastq.gz = input_1//Le1-13-502-701_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-13-502-701_2.fastq.gz = input_1//Le1-13-502-701_2.fastq.gz ']'
+ ppinputcheck=1
+ break
+ '[' 1 = 0 ']'
+ IFS=
+ read i
+ ppinputcheck=0
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-1-501-701_1.fastq.gz = input_1//Le1-17-502-703_1.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-12-501-708_1.fastq.gz = input_1//Le1-17-502-703_1.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-17-502-703_1.fastq.gz = input_1//Le1-17-502-703_1.fastq.gz ']'
+ ppinputcheck=1
+ break
+ '[' 1 = 0 ']'
+ IFS=
+ read i
+ ppinputcheck=0
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-1-501-701_1.fastq.gz = input_1//Le1-13-502-701_1.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-12-501-708_1.fastq.gz = input_1//Le1-13-502-701_1.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-17-502-703_1.fastq.gz = input_1//Le1-13-502-701_1.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-13-502-701_1.fastq.gz = input_1//Le1-13-502-701_1.fastq.gz ']'
+ ppinputcheck=1
+ break
+ '[' 1 = 0 ']'
+ IFS=
+ read i
+ mkdir -p output
+ (( i = 0 ))
+ xargs '-d\n' -I '{}' -P 1 bash -c '{}'
+ (( i < 4 ))
++ basename input_1//Le1-1-501-701_1.fastq.gz
+ prefix=output/Le1-1-501-701_1.fastq.gz
+ local_out_files=' rpkm=output/Le1-1-501-701_1.fastq.gz_rpkm.tsv covstats=output/Le1-1-501-701_1.fastq.gz_covstats.tsv'
+ echo 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  bbmap.sh ref="input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta" threads="14" in1="input_1//Le1-1-501-701_1.fastq.gz" in2="input_1//Le1-1-501-701_2.fastq.gz" out="output/Le1-1-501-701_1.fastq.gz".temp.bam maxindel=100000 maxsites2=10000  rpkm=output/Le1-1-501-701_1.fastq.gz_rpkm.tsv covstats=output/Le1-1-501-701_1.fastq.gz_covstats.tsv; PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  bash run-samtools.sh "output/Le1-1-501-701_1.fastq.gz".temp.bam "14" "ON" "6553"'
+ (( i++ ))
+ (( i < 4 ))
++ basename input_1//Le1-12-501-708_1.fastq.gz
+ prefix=output/Le1-12-501-708_1.fastq.gz
+ local_out_files=' rpkm=output/Le1-12-501-708_1.fastq.gz_rpkm.tsv covstats=output/Le1-12-501-708_1.fastq.gz_covstats.tsv'
+ echo 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  bbmap.sh ref="input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta" threads="14" in1="input_1//Le1-12-501-708_1.fastq.gz" in2="input_1//Le1-12-501-708_2.fastq.gz" out="output/Le1-12-501-708_1.fastq.gz".temp.bam maxindel=100000 maxsites2=10000  rpkm=output/Le1-12-501-708_1.fastq.gz_rpkm.tsv covstats=output/Le1-12-501-708_1.fastq.gz_covstats.tsv; PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  bash run-samtools.sh "output/Le1-12-501-708_1.fastq.gz".temp.bam "14" "ON" "6553"'
+ (( i++ ))
+ (( i < 4 ))
++ basename input_1//Le1-17-502-703_1.fastq.gz
+ prefix=output/Le1-17-502-703_1.fastq.gz
+ local_out_files=' rpkm=output/Le1-17-502-703_1.fastq.gz_rpkm.tsv covstats=output/Le1-17-502-703_1.fastq.gz_covstats.tsv'
+ echo 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  bbmap.sh ref="input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta" threads="14" in1="input_1//Le1-17-502-703_1.fastq.gz" in2="input_1//Le1-17-502-703_2.fastq.gz" out="output/Le1-17-502-703_1.fastq.gz".temp.bam maxindel=100000 maxsites2=10000  rpkm=output/Le1-17-502-703_1.fastq.gz_rpkm.tsv covstats=output/Le1-17-502-703_1.fastq.gz_covstats.tsv; PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  bash run-samtools.sh "output/Le1-17-502-703_1.fastq.gz".temp.bam "14" "ON" "6553"'
+ (( i++ ))
+ (( i < 4 ))
++ basename input_1//Le1-13-502-701_1.fastq.gz
+ prefix=output/Le1-13-502-701_1.fastq.gz
+ local_out_files=' rpkm=output/Le1-13-502-701_1.fastq.gz_rpkm.tsv covstats=output/Le1-13-502-701_1.fastq.gz_covstats.tsv'
+ echo 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  bbmap.sh ref="input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta" threads="14" in1="input_1//Le1-13-502-701_1.fastq.gz" in2="input_1//Le1-13-502-701_2.fastq.gz" out="output/Le1-13-502-701_1.fastq.gz".temp.bam maxindel=100000 maxsites2=10000  rpkm=output/Le1-13-502-701_1.fastq.gz_rpkm.tsv covstats=output/Le1-13-502-701_1.fastq.gz_covstats.tsv; PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  bash run-samtools.sh "output/Le1-13-502-701_1.fastq.gz".temp.bam "14" "ON" "6553"'
+ (( i++ ))
+ (( i < 4 ))
java -ea -Xmx109179m -Xms109179m -cp /usr/local/opt/bbmap-38.96-1/current/ align2.BBMap build=1 overwrite=true fastareadlen=500 ref=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta threads=14 in1=input_1//Le1-1-501-701_1.fastq.gz in2=input_1//Le1-1-501-701_2.fastq.gz out=output/Le1-1-501-701_1.fastq.gz.temp.bam maxindel=100000 maxsites2=10000 rpkm=output/Le1-1-501-701_1.fastq.gz_rpkm.tsv covstats=output/Le1-1-501-701_1.fastq.gz_covstats.tsv
Executing align2.BBMap [build=1, overwrite=true, fastareadlen=500, ref=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta, threads=14, in1=input_1//Le1-1-501-701_1.fastq.gz, in2=input_1//Le1-1-501-701_2.fastq.gz, out=output/Le1-1-501-701_1.fastq.gz.temp.bam, maxindel=100000, maxsites2=10000, rpkm=output/Le1-1-501-701_1.fastq.gz_rpkm.tsv, covstats=output/Le1-1-501-701_1.fastq.gz_covstats.tsv]
Version 38.96

Set threads to 14
Retaining first best site only for ambiguous mappings.
NOTE:	Ignoring reference file because it already appears to have been processed.
NOTE:	If you wish to regenerate the index, please manually delete ref/genome/1/summary.txt
Set genome to 1

Loaded Reference:	0.393 seconds.
Loading index for chunk 1-1, build 1
Generated Index:	1.164 seconds.
Analyzed Index:   	3.715 seconds.
Found samtools 1.15
Started output stream:	0.078 seconds.
Cleared Memory:    	0.213 seconds.
Processing reads in paired-ended mode.
Started read stream.
Started 14 mapping threads.
Checking the realpath of input files.
0 input_1/
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-1-501-701_1.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-1-501-701_2.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-12-501-708_1.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-12-501-708_2.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-17-502-703_2.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-13-502-701_2.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-17-502-703_1.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-13-502-701_1.fastq.gz
0 input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
script: /yoshitake/PortablePipeline/PortablePipeline/scripts/RNA-seq~SNPcall-bbmap-callvariants "$scriptdir"/mapping-illumina~bbmap
broadinstitute/gatk:4.3.0.0 centos:centos6 quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1 quay.io/biocontainers/picard:2.18.27--0
using docker
+ set -o pipefail
++ date +%s
+ time0=1677603490
+ echo start at 1677603490
start at 1677603490
+ bash /yoshitake/PortablePipeline/PortablePipeline/scripts/mapping-illumina~bbmap -c 16 -m 128 -i '' -j 'maxindel=100000 maxsites2=10000' -b ON -o ' ' input_1/ input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
Checking the realpath of input files.
0 input_1/
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-1-501-701_1.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-1-501-701_2.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-12-501-708_1.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-12-501-708_2.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-17-502-703_2.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-13-502-701_2.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-17-502-703_1.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-13-502-701_1.fastq.gz
0 input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
broadinstitute/gatk:4.3.0.0 centos:centos6 quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1 quay.io/biocontainers/picard:2.18.27--0
using docker
+ set -o pipefail
+ exec
++ tee log.txt
+ LANG=C
+ threads=16
+ three=16
++ expr 16 / 2
+ threads2=8
++ expr 16 - 2
+ threads1=14
+ '[' 14 -lt 1 ']'
++ free -g
++ grep Mem
++ sed -e 's/Mem: *\([0-9]*\) .*/\1/'
+ memG=251
++ expr 251 '*' 3 / 4
+ memG3=188
+ echo '
#####SYSTEM ENVIRONMENT#####
  threads=16
  memory=251G
############################
'

#####SYSTEM ENVIRONMENT#####
  threads=16
  memory=251G
############################

++ date +%s
+ time0=1677603491
+ echo start at 1677603491
start at 1677603491
+ echo -e 'Checking paramter settings...\n'
Checking paramter settings...

+ indexing_param=k=13
+ mapping_param='maxindel=100000 maxsites2=10000'
+ out_files=
+ mapped_only_bam=ON
++ echo input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
++ grep '[.]gz$'
++ wc -l
++ true
+ '[' 0 = 1 ']'
+ ref=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
+ FUNC_RUN_DOCKER quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1 bbmap.sh threads=16 k=13 ref=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
+ PP_RUN_IMAGE=quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1
+ shift
+ PP_RUN_DOCKER_CMD=("${@}")
++ date +%Y%m%d_%H%M%S_%3N
+ PPDOCNAME=pp20230301_015811_642_8631
+ echo pp20230301_015811_642_8631
++ id -u
++ id -g
+ docker run --name pp20230301_015811_642_8631 -v /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants:/yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants -w /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1 bbmap.sh threads=16 k=13 ref=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
java -ea -Xmx109180m -Xms109180m -cp /usr/local/opt/bbmap-38.96-1/current/ align2.BBMap build=1 overwrite=true fastareadlen=500 threads=16 k=13 ref=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
Executing align2.BBMap [build=1, overwrite=true, fastareadlen=500, threads=16, k=13, ref=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta]
Version 38.96

Set threads to 16
No output file.
NOTE:	Ignoring reference file because it already appears to have been processed.
NOTE:	If you wish to regenerate the index, please manually delete ref/genome/1/summary.txt
Set genome to 1

Loaded Reference:	0.388 seconds.
Loading index for chunk 1-1, build 1
Generated Index:	1.167 seconds.
No reads to process; quitting.

Total time:     	1.679 seconds.
+ cat
+ pppair1=()
+ pppair2=()
+ ppsingle=()
+ IFS=
+ read i
++ find input_1//
++ egrep '(_R1.*|_1)[.]f((ast|)(q|a)|na|sa)(|[.]gz)$'
++ echo input_1//Le1-1-501-701_1.fastq.gz
++ egrep '_1[.]f((ast|)(q|a)|na|sa)(|[.]gz)$'
++ wc -l
+ '[' 1 = 1 ']'
++ echo input_1//Le1-1-501-701_1.fastq.gz
++ sed 's/_1[.]\(f\(\(ast\|\)\(q\|a\)\|na\|sa\)\(\|[.]gz\)\)$/_2.\1/'
+ temppair2=input_1//Le1-1-501-701_2.fastq.gz
+ '[' -e input_1//Le1-1-501-701_2.fastq.gz ']'
+ pppair1+=("$i")
+ pppair2+=("$temppair2")
+ IFS=
+ read i
++ echo input_1//Le1-12-501-708_1.fastq.gz
++ egrep '_1[.]f((ast|)(q|a)|na|sa)(|[.]gz)$'
++ wc -l
+ '[' 1 = 1 ']'
++ echo input_1//Le1-12-501-708_1.fastq.gz
++ sed 's/_1[.]\(f\(\(ast\|\)\(q\|a\)\|na\|sa\)\(\|[.]gz\)\)$/_2.\1/'
+ temppair2=input_1//Le1-12-501-708_2.fastq.gz
+ '[' -e input_1//Le1-12-501-708_2.fastq.gz ']'
+ pppair1+=("$i")
+ pppair2+=("$temppair2")
+ IFS=
+ read i
++ echo input_1//Le1-17-502-703_1.fastq.gz
++ egrep '_1[.]f((ast|)(q|a)|na|sa)(|[.]gz)$'
++ wc -l
+ '[' 1 = 1 ']'
++ echo input_1//Le1-17-502-703_1.fastq.gz
++ sed 's/_1[.]\(f\(\(ast\|\)\(q\|a\)\|na\|sa\)\(\|[.]gz\)\)$/_2.\1/'
+ temppair2=input_1//Le1-17-502-703_2.fastq.gz
+ '[' -e input_1//Le1-17-502-703_2.fastq.gz ']'
+ pppair1+=("$i")
+ pppair2+=("$temppair2")
+ IFS=
+ read i
++ echo input_1//Le1-13-502-701_1.fastq.gz
++ wc -l
++ egrep '_1[.]f((ast|)(q|a)|na|sa)(|[.]gz)$'
+ '[' 1 = 1 ']'
++ echo input_1//Le1-13-502-701_1.fastq.gz
++ sed 's/_1[.]\(f\(\(ast\|\)\(q\|a\)\|na\|sa\)\(\|[.]gz\)\)$/_2.\1/'
+ temppair2=input_1//Le1-13-502-701_2.fastq.gz
+ '[' -e input_1//Le1-13-502-701_2.fastq.gz ']'
+ pppair1+=("$i")
+ pppair2+=("$temppair2")
+ IFS=
+ read i
+ IFS=
+ read i
++ find input_1//
++ egrep '[.]f((ast|)(q|a)|na|sa)(|[.]gz)$'
+ ppinputcheck=0
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-1-501-701_1.fastq.gz = input_1//Le1-1-501-701_1.fastq.gz ']'
+ ppinputcheck=1
+ break
+ '[' 1 = 0 ']'
+ IFS=
+ read i
+ ppinputcheck=0
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-1-501-701_1.fastq.gz = input_1//Le1-1-501-701_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-12-501-708_1.fastq.gz = input_1//Le1-1-501-701_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-17-502-703_1.fastq.gz = input_1//Le1-1-501-701_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-13-502-701_1.fastq.gz = input_1//Le1-1-501-701_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-1-501-701_2.fastq.gz = input_1//Le1-1-501-701_2.fastq.gz ']'
+ ppinputcheck=1
+ break
+ '[' 1 = 0 ']'
+ IFS=
+ read i
+ ppinputcheck=0
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-1-501-701_1.fastq.gz = input_1//Le1-12-501-708_1.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-12-501-708_1.fastq.gz = input_1//Le1-12-501-708_1.fastq.gz ']'
+ ppinputcheck=1
+ break
+ '[' 1 = 0 ']'
+ IFS=
+ read i
+ ppinputcheck=0
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-1-501-701_1.fastq.gz = input_1//Le1-12-501-708_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-12-501-708_1.fastq.gz = input_1//Le1-12-501-708_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-17-502-703_1.fastq.gz = input_1//Le1-12-501-708_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-13-502-701_1.fastq.gz = input_1//Le1-12-501-708_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-1-501-701_2.fastq.gz = input_1//Le1-12-501-708_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-12-501-708_2.fastq.gz = input_1//Le1-12-501-708_2.fastq.gz ']'
+ ppinputcheck=1
+ break
+ '[' 1 = 0 ']'
+ IFS=
+ read i
+ ppinputcheck=0
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-1-501-701_1.fastq.gz = input_1//Le1-17-502-703_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-12-501-708_1.fastq.gz = input_1//Le1-17-502-703_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-17-502-703_1.fastq.gz = input_1//Le1-17-502-703_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-13-502-701_1.fastq.gz = input_1//Le1-17-502-703_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-1-501-701_2.fastq.gz = input_1//Le1-17-502-703_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-12-501-708_2.fastq.gz = input_1//Le1-17-502-703_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-17-502-703_2.fastq.gz = input_1//Le1-17-502-703_2.fastq.gz ']'
+ ppinputcheck=1
+ break
+ '[' 1 = 0 ']'
+ IFS=
+ read i
+ ppinputcheck=0
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-1-501-701_1.fastq.gz = input_1//Le1-13-502-701_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-12-501-708_1.fastq.gz = input_1//Le1-13-502-701_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-17-502-703_1.fastq.gz = input_1//Le1-13-502-701_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-13-502-701_1.fastq.gz = input_1//Le1-13-502-701_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-1-501-701_2.fastq.gz = input_1//Le1-13-502-701_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-12-501-708_2.fastq.gz = input_1//Le1-13-502-701_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-17-502-703_2.fastq.gz = input_1//Le1-13-502-701_2.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-13-502-701_2.fastq.gz = input_1//Le1-13-502-701_2.fastq.gz ']'
+ ppinputcheck=1
+ break
+ '[' 1 = 0 ']'
+ IFS=
+ read i
+ ppinputcheck=0
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-1-501-701_1.fastq.gz = input_1//Le1-17-502-703_1.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-12-501-708_1.fastq.gz = input_1//Le1-17-502-703_1.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-17-502-703_1.fastq.gz = input_1//Le1-17-502-703_1.fastq.gz ']'
+ ppinputcheck=1
+ break
+ '[' 1 = 0 ']'
+ IFS=
+ read i
+ ppinputcheck=0
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-1-501-701_1.fastq.gz = input_1//Le1-13-502-701_1.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-12-501-708_1.fastq.gz = input_1//Le1-13-502-701_1.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-17-502-703_1.fastq.gz = input_1//Le1-13-502-701_1.fastq.gz ']'
+ for j in '${pppair1[@]:-}' '${pppair2[@]:-}' '${ppsingle[@]:-}'
+ '[' input_1//Le1-13-502-701_1.fastq.gz = input_1//Le1-13-502-701_1.fastq.gz ']'
+ ppinputcheck=1
+ break
+ '[' 1 = 0 ']'
+ IFS=
+ read i
+ mkdir -p output
+ (( i = 0 ))
+ (( i < 4 ))
+ xargs '-d\n' -I '{}' -P 1 bash -c '{}'
++ basename input_1//Le1-1-501-701_1.fastq.gz
+ prefix=output/Le1-1-501-701_1.fastq.gz
+ local_out_files=
+ echo 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  bbmap.sh ref="input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta" threads="14" in1="input_1//Le1-1-501-701_1.fastq.gz" in2="input_1//Le1-1-501-701_2.fastq.gz" out="output/Le1-1-501-701_1.fastq.gz".temp.bam maxindel=100000 maxsites2=10000 ; PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  bash run-samtools.sh "output/Le1-1-501-701_1.fastq.gz".temp.bam "14" "ON" "6553"'
+ (( i++ ))
+ (( i < 4 ))
++ basename input_1//Le1-12-501-708_1.fastq.gz
+ prefix=output/Le1-12-501-708_1.fastq.gz
+ local_out_files=
+ echo 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  bbmap.sh ref="input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta" threads="14" in1="input_1//Le1-12-501-708_1.fastq.gz" in2="input_1//Le1-12-501-708_2.fastq.gz" out="output/Le1-12-501-708_1.fastq.gz".temp.bam maxindel=100000 maxsites2=10000 ; PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  bash run-samtools.sh "output/Le1-12-501-708_1.fastq.gz".temp.bam "14" "ON" "6553"'
+ (( i++ ))
+ (( i < 4 ))
++ basename input_1//Le1-17-502-703_1.fastq.gz
+ prefix=output/Le1-17-502-703_1.fastq.gz
+ local_out_files=
+ echo 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  bbmap.sh ref="input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta" threads="14" in1="input_1//Le1-17-502-703_1.fastq.gz" in2="input_1//Le1-17-502-703_2.fastq.gz" out="output/Le1-17-502-703_1.fastq.gz".temp.bam maxindel=100000 maxsites2=10000 ; PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  bash run-samtools.sh "output/Le1-17-502-703_1.fastq.gz".temp.bam "14" "ON" "6553"'
+ (( i++ ))
+ (( i < 4 ))
++ basename input_1//Le1-13-502-701_1.fastq.gz
+ prefix=output/Le1-13-502-701_1.fastq.gz
+ local_out_files=
+ echo 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  bbmap.sh ref="input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta" threads="14" in1="input_1//Le1-13-502-701_1.fastq.gz" in2="input_1//Le1-13-502-701_2.fastq.gz" out="output/Le1-13-502-701_1.fastq.gz".temp.bam maxindel=100000 maxsites2=10000 ; PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  bash run-samtools.sh "output/Le1-13-502-701_1.fastq.gz".temp.bam "14" "ON" "6553"'
+ (( i++ ))
+ (( i < 4 ))
java -ea -Xmx109193m -Xms109193m -cp /usr/local/opt/bbmap-38.96-1/current/ align2.BBMap build=1 overwrite=true fastareadlen=500 ref=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta threads=14 in1=input_1//Le1-1-501-701_1.fastq.gz in2=input_1//Le1-1-501-701_2.fastq.gz out=output/Le1-1-501-701_1.fastq.gz.temp.bam maxindel=100000 maxsites2=10000
Executing align2.BBMap [build=1, overwrite=true, fastareadlen=500, ref=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta, threads=14, in1=input_1//Le1-1-501-701_1.fastq.gz, in2=input_1//Le1-1-501-701_2.fastq.gz, out=output/Le1-1-501-701_1.fastq.gz.temp.bam, maxindel=100000, maxsites2=10000]
Version 38.96

Set threads to 14
Retaining first best site only for ambiguous mappings.
NOTE:	Ignoring reference file because it already appears to have been processed.
NOTE:	If you wish to regenerate the index, please manually delete ref/genome/1/summary.txt
Set genome to 1

Loaded Reference:	0.390 seconds.
Loading index for chunk 1-1, build 1
Generated Index:	1.137 seconds.
Analyzed Index:   	3.456 seconds.
Found samtools 1.15
Started output stream:	0.077 seconds.
Cleared Memory:    	0.216 seconds.
Processing reads in paired-ended mode.
Started read stream.
Started 14 mapping threads.
Detecting finished threads: 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13

   ------------------   Results   ------------------   

Genome:                	1
Key Length:            	13
Max Indel:             	100000
Minimum Score Ratio:  	0.56
Mapping Mode:         	normal
Reads Used:           	2000000	(302000000 bases)

Mapping:          	196.157 seconds.
Reads/sec:       	10195.91
kBases/sec:      	1539.58


Pairing data:   	pct pairs	num pairs 	pct bases	   num bases

mated pairs:     	  6.0242% 	    60242 	  6.0242% 	    18193084
bad pairs:       	  0.4714% 	     4714 	  0.4714% 	     1423628
insert size avg: 	  292.18


Read 1 data:      	pct reads	num reads 	pct bases	   num bases

mapped:          	  6.9196% 	    69196 	  6.9196% 	    10448596
unambiguous:     	  5.0213% 	    50213 	  5.0213% 	     7582163
ambiguous:       	  1.8983% 	    18983 	  1.8983% 	     2866433
low-Q discards:  	  0.0000% 	        0 	  0.0000% 	           0

perfect best site:	  3.6137% 	    36137 	  3.6137% 	     5456687
semiperfect site:	  3.6238% 	    36238 	  3.6238% 	     5471938
rescued:         	  0.4217% 	     4217

Match Rate:      	      NA 	       NA 	 36.7648% 	    10022613
Error Rate:      	 47.7687% 	    33054 	 63.2324% 	    17238085
Sub Rate:        	 45.2584% 	    31317 	  0.9840% 	      268259
Del Rate:        	 10.4096% 	     7203 	 61.6727% 	    16812873
Ins Rate:        	 17.3464% 	    12003 	  0.5757% 	      156953
N Rate:          	  0.0361% 	       25 	  0.0028% 	         771


Read 2 data:      	pct reads	num reads 	pct bases	   num bases

mapped:          	  6.8722% 	    68722 	  6.8722% 	    10377022
unambiguous:     	  4.9803% 	    49803 	  4.9803% 	     7520253
ambiguous:       	  1.8919% 	    18919 	  1.8919% 	     2856769
low-Q discards:  	  0.0000% 	        0 	  0.0000% 	           0

perfect best site:	  3.2269% 	    32269 	  3.2269% 	     4872619
semiperfect site:	  3.2366% 	    32366 	  3.2366% 	     4887266
rescued:         	  0.5981% 	     5981

Match Rate:      	      NA 	       NA 	 37.3713% 	     9913213
Error Rate:      	 53.0179% 	    36436 	 62.6258% 	    16612276
Sub Rate:        	 50.7450% 	    34874 	  1.1370% 	      301606
Del Rate:        	 10.2773% 	     7063 	 60.8802% 	    16149229
Ins Rate:        	 17.2429% 	    11850 	  0.6086% 	      161441
N Rate:          	  0.0757% 	       52 	  0.0029% 	         762

Total time:     	201.581 seconds.
calulating flagstat...
Sorting and indexing bam
[bam_sort_core] merging from 0 files and 14 in-memory blocks...
Counting mapped reads...
java -ea -Xmx109193m -Xms109193m -cp /usr/local/opt/bbmap-38.96-1/current/ align2.BBMap build=1 overwrite=true fastareadlen=500 ref=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta threads=14 in1=input_1//Le1-12-501-708_1.fastq.gz in2=input_1//Le1-12-501-708_2.fastq.gz out=output/Le1-12-501-708_1.fastq.gz.temp.bam maxindel=100000 maxsites2=10000
Executing align2.BBMap [build=1, overwrite=true, fastareadlen=500, ref=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta, threads=14, in1=input_1//Le1-12-501-708_1.fastq.gz, in2=input_1//Le1-12-501-708_2.fastq.gz, out=output/Le1-12-501-708_1.fastq.gz.temp.bam, maxindel=100000, maxsites2=10000]
Version 38.96

Set threads to 14
Retaining first best site only for ambiguous mappings.
NOTE:	Ignoring reference file because it already appears to have been processed.
NOTE:	If you wish to regenerate the index, please manually delete ref/genome/1/summary.txt
Set genome to 1

Loaded Reference:	0.376 seconds.
Loading index for chunk 1-1, build 1
Generated Index:	1.131 seconds.
Analyzed Index:   	3.415 seconds.
Found samtools 1.15
Started output stream:	0.057 seconds.
Cleared Memory:    	0.214 seconds.
Processing reads in paired-ended mode.
Started read stream.
Started 14 mapping threads.
Detecting finished threads: 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13

   ------------------   Results   ------------------   

Genome:                	1
Key Length:            	13
Max Indel:             	100000
Minimum Score Ratio:  	0.56
Mapping Mode:         	normal
Reads Used:           	2000000	(302000000 bases)

Mapping:          	58.933 seconds.
Reads/sec:       	33936.77
kBases/sec:      	5124.45


Pairing data:   	pct pairs	num pairs 	pct bases	   num bases

mated pairs:     	  0.6166% 	     6166 	  0.6166% 	     1862132
bad pairs:       	  0.0829% 	      829 	  0.0829% 	      250358
insert size avg: 	  417.26


Read 1 data:      	pct reads	num reads 	pct bases	   num bases

mapped:          	  0.8171% 	     8171 	  0.8171% 	     1233821
unambiguous:     	  0.5003% 	     5003 	  0.5003% 	      755453
ambiguous:       	  0.3168% 	     3168 	  0.3168% 	      478368
low-Q discards:  	  0.0000% 	        0 	  0.0000% 	           0

perfect best site:	  0.4606% 	     4606 	  0.4606% 	      695506
semiperfect site:	  0.4628% 	     4628 	  0.4628% 	      698828
rescued:         	  0.0489% 	      489

Match Rate:      	      NA 	       NA 	 15.3850% 	     1187753
Error Rate:      	 43.6299% 	     3565 	 84.6150% 	     6532460
Sub Rate:        	 38.7590% 	     3167 	  0.3571% 	       27571
Del Rate:        	 10.8799% 	      889 	 84.0183% 	     6486393
Ins Rate:        	 18.6146% 	     1521 	  0.2396% 	       18496
N Rate:          	  0.0122% 	        1 	  0.0000% 	           1


Read 2 data:      	pct reads	num reads 	pct bases	   num bases

mapped:          	  0.8057% 	     8057 	  0.8057% 	     1216607
unambiguous:     	  0.4938% 	     4938 	  0.4938% 	      745638
ambiguous:       	  0.3119% 	     3119 	  0.3119% 	      470969
low-Q discards:  	  0.0000% 	        0 	  0.0000% 	           0

perfect best site:	  0.4006% 	     4006 	  0.4006% 	      604906
semiperfect site:	  0.4035% 	     4035 	  0.4035% 	      609285
rescued:         	  0.0759% 	      759

Match Rate:      	      NA 	       NA 	 17.3427% 	     1166567
Error Rate:      	 50.2668% 	     4050 	 82.6568% 	     5559955
Sub Rate:        	 46.2083% 	     3723 	  0.4822% 	       32433
Del Rate:        	 10.6739% 	      860 	 81.9134% 	     5509951
Ins Rate:        	 17.4755% 	     1408 	  0.2612% 	       17571
N Rate:          	  0.0621% 	        5 	  0.0005% 	          36

Total time:     	64.253 seconds.
calulating flagstat...
Sorting and indexing bam
[bam_sort_core] merging from 0 files and 14 in-memory blocks...
Counting mapped reads...
java -ea -Xmx109181m -Xms109181m -cp /usr/local/opt/bbmap-38.96-1/current/ align2.BBMap build=1 overwrite=true fastareadlen=500 ref=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta threads=14 in1=input_1//Le1-17-502-703_1.fastq.gz in2=input_1//Le1-17-502-703_2.fastq.gz out=output/Le1-17-502-703_1.fastq.gz.temp.bam maxindel=100000 maxsites2=10000
Executing align2.BBMap [build=1, overwrite=true, fastareadlen=500, ref=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta, threads=14, in1=input_1//Le1-17-502-703_1.fastq.gz, in2=input_1//Le1-17-502-703_2.fastq.gz, out=output/Le1-17-502-703_1.fastq.gz.temp.bam, maxindel=100000, maxsites2=10000]
Version 38.96

Set threads to 14
Retaining first best site only for ambiguous mappings.
NOTE:	Ignoring reference file because it already appears to have been processed.
NOTE:	If you wish to regenerate the index, please manually delete ref/genome/1/summary.txt
Set genome to 1

Loaded Reference:	0.373 seconds.
Loading index for chunk 1-1, build 1
Generated Index:	1.079 seconds.
Analyzed Index:   	3.421 seconds.
Found samtools 1.15
Started output stream:	0.072 seconds.
Cleared Memory:    	0.188 seconds.
Processing reads in paired-ended mode.
Started read stream.
Started 14 mapping threads.
Detecting finished threads: 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13

   ------------------   Results   ------------------   

Genome:                	1
Key Length:            	13
Max Indel:             	100000
Minimum Score Ratio:  	0.56
Mapping Mode:         	normal
Reads Used:           	2000000	(302000000 bases)

Mapping:          	807.637 seconds.
Reads/sec:       	2476.36
kBases/sec:      	373.93


Pairing data:   	pct pairs	num pairs 	pct bases	   num bases

mated pairs:     	 28.3931% 	   283931 	 28.3931% 	    85747162
bad pairs:       	  2.5956% 	    25956 	  2.5956% 	     7838712
insert size avg: 	  339.04


Read 1 data:      	pct reads	num reads 	pct bases	   num bases

mapped:          	 32.5483% 	   325483 	 32.5483% 	    49147933
unambiguous:     	 21.6019% 	   216019 	 21.6019% 	    32618869
ambiguous:       	 10.9464% 	   109464 	 10.9464% 	    16529064
low-Q discards:  	  0.0000% 	        0 	  0.0000% 	           0

perfect best site:	 20.6655% 	   206655 	 20.6655% 	    31204905
semiperfect site:	 20.7156% 	   207156 	 20.7156% 	    31280556
rescued:         	  1.7673% 	    17673

Match Rate:      	      NA 	       NA 	 31.7415% 	    48059882
Error Rate:      	 36.4949% 	   118786 	 68.2563% 	   103347167
Sub Rate:        	 34.2766% 	   111566 	  0.4938% 	      747709
Del Rate:        	  7.8980% 	    25707 	 67.5399% 	   102262431
Ins Rate:        	  9.4446% 	    30741 	  0.2226% 	      337027
N Rate:          	  0.0418% 	      136 	  0.0022% 	        3315


Read 2 data:      	pct reads	num reads 	pct bases	   num bases

mapped:          	 32.2561% 	   322561 	 32.2561% 	    48706711
unambiguous:     	 21.3931% 	   213931 	 21.3931% 	    32303581
ambiguous:       	 10.8630% 	   108630 	 10.8630% 	    16403130
low-Q discards:  	  0.0000% 	        0 	  0.0000% 	           0

perfect best site:	 17.8848% 	   178848 	 17.8848% 	    27006048
semiperfect site:	 17.9266% 	   179266 	 17.9266% 	    27069166
rescued:         	  2.1757% 	    21757

Match Rate:      	      NA 	       NA 	 32.4895% 	    47428610
Error Rate:      	 44.5292% 	   143636 	 67.5075% 	    98548430
Sub Rate:        	 42.5829% 	   137358 	  0.6448% 	      941299
Del Rate:        	  7.7231% 	    24912 	 66.6350% 	    97274658
Ins Rate:        	  9.4052% 	    30338 	  0.2278% 	      332473
N Rate:          	  0.0741% 	      239 	  0.0030% 	        4329

Total time:     	812.905 seconds.
calulating flagstat...
Sorting and indexing bam
[bam_sort_core] merging from 0 files and 14 in-memory blocks...
Counting mapped reads...
java -ea -Xmx109194m -Xms109194m -cp /usr/local/opt/bbmap-38.96-1/current/ align2.BBMap build=1 overwrite=true fastareadlen=500 ref=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta threads=14 in1=input_1//Le1-13-502-701_1.fastq.gz in2=input_1//Le1-13-502-701_2.fastq.gz out=output/Le1-13-502-701_1.fastq.gz.temp.bam maxindel=100000 maxsites2=10000
Executing align2.BBMap [build=1, overwrite=true, fastareadlen=500, ref=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta, threads=14, in1=input_1//Le1-13-502-701_1.fastq.gz, in2=input_1//Le1-13-502-701_2.fastq.gz, out=output/Le1-13-502-701_1.fastq.gz.temp.bam, maxindel=100000, maxsites2=10000]
Version 38.96

Set threads to 14
Retaining first best site only for ambiguous mappings.
NOTE:	Ignoring reference file because it already appears to have been processed.
NOTE:	If you wish to regenerate the index, please manually delete ref/genome/1/summary.txt
Set genome to 1

Loaded Reference:	0.382 seconds.
Loading index for chunk 1-1, build 1
Generated Index:	1.153 seconds.
Analyzed Index:   	3.522 seconds.
Found samtools 1.15
Started output stream:	0.066 seconds.
Cleared Memory:    	0.195 seconds.
Processing reads in paired-ended mode.
Started read stream.
Started 14 mapping threads.
Detecting finished threads: 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13

   ------------------   Results   ------------------   

Genome:                	1
Key Length:            	13
Max Indel:             	100000
Minimum Score Ratio:  	0.56
Mapping Mode:         	normal
Reads Used:           	2000000	(302000000 bases)

Mapping:          	250.440 seconds.
Reads/sec:       	7985.95
kBases/sec:      	1205.88


Pairing data:   	pct pairs	num pairs 	pct bases	   num bases

mated pairs:     	 10.0927% 	   100927 	 10.0927% 	    30479954
bad pairs:       	  0.8867% 	     8867 	  0.8867% 	     2677834
insert size avg: 	  381.70


Read 1 data:      	pct reads	num reads 	pct bases	   num bases

mapped:          	 11.6839% 	   116839 	 11.6839% 	    17642689
unambiguous:     	  8.1950% 	    81950 	  8.1950% 	    12374450
ambiguous:       	  3.4889% 	    34889 	  3.4889% 	     5268239
low-Q discards:  	  0.0000% 	        0 	  0.0000% 	           0

perfect best site:	  7.5404% 	    75404 	  7.5404% 	    11386004
semiperfect site:	  7.5537% 	    75537 	  7.5537% 	    11406087
rescued:         	  0.6799% 	     6799

Match Rate:      	      NA 	       NA 	 33.2878% 	    17247522
Error Rate:      	 35.4462% 	    41415 	 66.7094% 	    34564390
Sub Rate:        	 32.7006% 	    38207 	  0.4974% 	      257723
Del Rate:        	  7.6969% 	     8993 	 65.9495% 	    34170663
Ins Rate:        	 10.3048% 	    12040 	  0.2625% 	      136004
N Rate:          	  0.0462% 	       54 	  0.0028% 	        1440


Read 2 data:      	pct reads	num reads 	pct bases	   num bases

mapped:          	 11.5805% 	   115805 	 11.5805% 	    17486555
unambiguous:     	  8.1197% 	    81197 	  8.1197% 	    12260747
ambiguous:       	  3.4608% 	    34608 	  3.4608% 	     5225808
low-Q discards:  	  0.0000% 	        0 	  0.0000% 	           0

perfect best site:	  6.2792% 	    62792 	  6.2792% 	     9481592
semiperfect site:	  6.2914% 	    62914 	  6.2914% 	     9500014
rescued:         	  0.8684% 	     8684

Match Rate:      	      NA 	       NA 	 34.6408% 	    17006518
Error Rate:      	 45.7507% 	    52982 	 65.3551% 	    32085334
Sub Rate:        	 43.3466% 	    50198 	  0.6998% 	      343567
Del Rate:        	  7.5782% 	     8776 	 64.3814% 	    31607304
Ins Rate:        	 10.1117% 	    11710 	  0.2739% 	      134463
N Rate:          	  0.0786% 	       91 	  0.0041% 	        2007

Total time:     	255.895 seconds.
calulating flagstat...
Sorting and indexing bam
[bam_sort_core] merging from 0 files and 14 in-memory blocks...
Counting mapped reads...
++ date
+ echo completion at Wed Mar 1 02:20:44 JST 2023
completion at Wed Mar 1 02:20:44 JST 2023
++ date +%s
+ time_fin=1677604844
++ echo 'scale=2; (1677604844 - 1677603491)/60'
++ bc
+ echo -e 'Total running time is 22.55 min'
Total running time is 22.55 min
+ echo 'Run completed!'
Run completed!
+ post_processing
+ '[' 2 = 1 ']'
+ exit
++ echo input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
++ grep '[.]gz$'
++ wc -l
++ true
+ '[' 0 = 1 ']'
+ ref=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
++ echo input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
++ sed 's/[.]\(fa\|fasta\|fsa\|fna\)$//'
+ refbase=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg
+ FUNC_RUN_DOCKER quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1 samtools faidx input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
+ PP_RUN_IMAGE=quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1
+ shift
+ PP_RUN_DOCKER_CMD=("${@}")
++ date +%Y%m%d_%H%M%S_%3N
+ PPDOCNAME=pp20230301_022044_781_15034
+ echo pp20230301_022044_781_15034
++ id -u
++ id -g
+ docker run --name pp20230301_022044_781_15034 -v /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants:/yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants -w /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1 samtools faidx input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
+ FUNC_RUN_DOCKER quay.io/biocontainers/picard:2.18.27--0 picard -Xmx104857M CreateSequenceDictionary R=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta O=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.dict
+ PP_RUN_IMAGE=quay.io/biocontainers/picard:2.18.27--0
+ shift
+ PP_RUN_DOCKER_CMD=("${@}")
++ date +%Y%m%d_%H%M%S_%3N
+ PPDOCNAME=pp20230301_022045_717_10950
+ echo pp20230301_022045_717_10950
++ id -u
++ id -g
+ docker run --name pp20230301_022045_717_10950 -v /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants:/yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants -w /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants -u 2007:600 -i --rm quay.io/biocontainers/picard:2.18.27--0 picard -Xmx104857M CreateSequenceDictionary R=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta O=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.dict
/usr/local/bin/picard: line 5: warning: setlocale: LC_ALL: cannot change locale (en_US.UTF-8): No such file or directory
INFO	2023-02-28 17:20:46	CreateSequenceDictionary	

********** NOTE: Picard's command line syntax is changing.
**********
********** For more information, please see:
********** https://github.com/broadinstitute/picard/wiki/Command-Line-Syntax-Transition-For-Users-(Pre-Transition)
**********
********** The command line looks like this in the new syntax:
**********
**********    CreateSequenceDictionary -R input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta -O input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.dict
**********


17:20:47.401 INFO  NativeLibraryLoader - Loading libgkl_compression.so from jar:file:/usr/local/share/picard-2.18.27-0/picard.jar!/com/intel/gkl/native/libgkl_compression.so
[Tue Feb 28 17:20:47 GMT 2023] CreateSequenceDictionary OUTPUT=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.dict REFERENCE=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta    TRUNCATE_NAMES_AT_WHITESPACE=true NUM_SEQUENCES=2147483647 VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false GA4GH_CLIENT_SECRETS=client_secrets.json USE_JDK_DEFLATER=false USE_JDK_INFLATER=false
[Tue Feb 28 17:20:47 GMT 2023] Executing as ?@49b6953b65e9 on Linux 3.10.0-1160.36.2.el7.x86_64 amd64; OpenJDK 64-Bit Server VM 11.0.1+13-LTS; Deflater: Intel; Inflater: Intel; Provider GCS is not available; Picard version: 2.18.27-SNAPSHOT
[Tue Feb 28 17:20:47 GMT 2023] picard.sam.CreateSequenceDictionary done. Elapsed time: 0.01 minutes.
Runtime.totalMemory()=2147483648
+ cat
+ mkdir -p output.temp output2
+ read i
+ xargs '-d\n' -I '{}' -P 1 bash -c '{}'
+ ls output/Le1-1-501-701_1.fastq.gz.bam output/Le1-12-501-708_1.fastq.gz.bam output/Le1-13-502-701_1.fastq.gz.bam output/Le1-17-502-703_1.fastq.gz.bam
++ basenmae output/Le1-1-501-701_1.fastq.gz.bam .bam
/yoshitake/PortablePipeline/PortablePipeline/scripts/RNA-seq~SNPcall-bbmap-callvariants: 行 56: basenmae: コマンドが見つかりません
+ j=
++ onerror 61
++ status=1
++ script=/yoshitake/PortablePipeline/PortablePipeline/scripts/RNA-seq~SNPcall-bbmap-callvariants
++ line=61
++ shift
++ set +x

------------------------------------------------------------
Error occured on /yoshitake/PortablePipeline/PortablePipeline/scripts/RNA-seq~SNPcall-bbmap-callvariants [Line 61]: Status 1

PID: 348967
User: yoshitake.kazutoshi
Current directory: /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants
Command line: /yoshitake/PortablePipeline/PortablePipeline/scripts/RNA-seq~SNPcall-bbmap-callvariants 
------------------------------------------------------------

PID: 348965
pp runtime error.
Checking the realpath of input files.
0 input_1/
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-1-501-701_1.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-1-501-701_2.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-12-501-708_1.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-12-501-708_2.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-17-502-703_2.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-13-502-701_2.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-17-502-703_1.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-13-502-701_1.fastq.gz
0 input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
script: /yoshitake/PortablePipeline/PortablePipeline/scripts/RNA-seq~SNPcall-bbmap-callvariants "$scriptdir"/mapping-illumina~bbmap
broadinstitute/gatk:4.3.0.0 centos:centos6 quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1 quay.io/biocontainers/picard:2.18.27--0
using docker
+ set -o pipefail
++ date +%s
+ time0=1677627175
+ echo start at 1677627175
start at 1677627175
++ echo input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
++ grep '[.]gz$'
++ wc -l
++ true
+ '[' 0 = 1 ']'
+ ref=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
++ echo input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
++ sed 's/[.]\(fa\|fasta\|fsa\|fna\)$//'
+ refbase=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg
+ FUNC_RUN_DOCKER quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1 samtools faidx input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
+ PP_RUN_IMAGE=quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1
+ shift
+ PP_RUN_DOCKER_CMD=("${@}")
++ date +%Y%m%d_%H%M%S_%3N
+ PPDOCNAME=pp20230301_083255_301_249
+ echo pp20230301_083255_301_249
++ id -u
++ id -g
+ docker run --name pp20230301_083255_301_249 -v /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants:/yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants -w /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1 samtools faidx input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
+ FUNC_RUN_DOCKER quay.io/biocontainers/picard:2.18.27--0 picard -Xmx104857M CreateSequenceDictionary R=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta O=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.dict
+ PP_RUN_IMAGE=quay.io/biocontainers/picard:2.18.27--0
+ shift
+ PP_RUN_DOCKER_CMD=("${@}")
++ date +%Y%m%d_%H%M%S_%3N
+ PPDOCNAME=pp20230301_083256_208_845
+ echo pp20230301_083256_208_845
++ id -u
++ id -g
+ docker run --name pp20230301_083256_208_845 -v /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants:/yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants -w /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants -u 2007:600 -i --rm quay.io/biocontainers/picard:2.18.27--0 picard -Xmx104857M CreateSequenceDictionary R=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta O=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.dict
/usr/local/bin/picard: line 5: warning: setlocale: LC_ALL: cannot change locale (en_US.UTF-8): No such file or directory
INFO	2023-02-28 23:32:57	CreateSequenceDictionary	

********** NOTE: Picard's command line syntax is changing.
**********
********** For more information, please see:
********** https://github.com/broadinstitute/picard/wiki/Command-Line-Syntax-Transition-For-Users-(Pre-Transition)
**********
********** The command line looks like this in the new syntax:
**********
**********    CreateSequenceDictionary -R input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta -O input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.dict
**********


23:32:57.543 INFO  NativeLibraryLoader - Loading libgkl_compression.so from jar:file:/usr/local/share/picard-2.18.27-0/picard.jar!/com/intel/gkl/native/libgkl_compression.so
[Tue Feb 28 23:32:57 GMT 2023] CreateSequenceDictionary OUTPUT=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.dict REFERENCE=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta    TRUNCATE_NAMES_AT_WHITESPACE=true NUM_SEQUENCES=2147483647 VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false GA4GH_CLIENT_SECRETS=client_secrets.json USE_JDK_DEFLATER=false USE_JDK_INFLATER=false
[Tue Feb 28 23:32:57 GMT 2023] Executing as ?@02a181fd478b on Linux 3.10.0-1160.36.2.el7.x86_64 amd64; OpenJDK 64-Bit Server VM 11.0.1+13-LTS; Deflater: Intel; Inflater: Intel; Provider GCS is not available; Picard version: 2.18.27-SNAPSHOT
[Tue Feb 28 23:32:57 GMT 2023] picard.sam.CreateSequenceDictionary done. Elapsed time: 0.00 minutes.
Runtime.totalMemory()=2147483648
To get help, see http://broadinstitute.github.io/picard/index.html#GettingHelp
Exception in thread "main" picard.PicardException: /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.dict already exists.  Delete this file and try again, or specify a different output file.
	at picard.sam.CreateSequenceDictionary.doWork(CreateSequenceDictionary.java:209)
	at picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:295)
	at picard.cmdline.PicardCommandLine.instanceMain(PicardCommandLine.java:103)
	at picard.cmdline.PicardCommandLine.main(PicardCommandLine.java:113)
PID: 403851
pp runtime error.
Checking the realpath of input files.
0 input_1/
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-1-501-701_1.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-1-501-701_2.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-12-501-708_1.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-12-501-708_2.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-17-502-703_2.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-13-502-701_2.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-17-502-703_1.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-13-502-701_1.fastq.gz
0 input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
script: /yoshitake/PortablePipeline/PortablePipeline/scripts/RNA-seq~SNPcall-bbmap-callvariants "$scriptdir"/mapping-illumina~bbmap
broadinstitute/gatk:4.3.0.0 centos:centos6 quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1 quay.io/biocontainers/picard:2.18.27--0
using docker
+ set -o pipefail
++ date +%s
+ time0=1677627548
+ echo start at 1677627548
start at 1677627548
++ echo input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
++ grep '[.]gz$'
++ wc -l
++ true
+ '[' 0 = 1 ']'
+ ref=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
++ echo input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
++ sed 's/[.]\(fa\|fasta\|fsa\|fna\)$//'
+ refbase=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg
+ FUNC_RUN_DOCKER quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1 samtools faidx input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
+ PP_RUN_IMAGE=quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1
+ shift
+ PP_RUN_DOCKER_CMD=("${@}")
++ date +%Y%m%d_%H%M%S_%3N
+ PPDOCNAME=pp20230301_083908_407_13623
+ echo pp20230301_083908_407_13623
++ id -u
++ id -g
+ docker run --name pp20230301_083908_407_13623 -v /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants:/yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants -w /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1 samtools faidx input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
+ rm -f input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.dict
+ FUNC_RUN_DOCKER quay.io/biocontainers/picard:2.18.27--0 picard -Xmx104857M CreateSequenceDictionary R=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta O=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.dict
+ PP_RUN_IMAGE=quay.io/biocontainers/picard:2.18.27--0
+ shift
+ PP_RUN_DOCKER_CMD=("${@}")
++ date +%Y%m%d_%H%M%S_%3N
+ PPDOCNAME=pp20230301_083909_334_23984
+ echo pp20230301_083909_334_23984
++ id -u
++ id -g
+ docker run --name pp20230301_083909_334_23984 -v /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants:/yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants -w /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants -u 2007:600 -i --rm quay.io/biocontainers/picard:2.18.27--0 picard -Xmx104857M CreateSequenceDictionary R=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta O=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.dict
/usr/local/bin/picard: line 5: warning: setlocale: LC_ALL: cannot change locale (en_US.UTF-8): No such file or directory
INFO	2023-02-28 23:39:10	CreateSequenceDictionary	

********** NOTE: Picard's command line syntax is changing.
**********
********** For more information, please see:
********** https://github.com/broadinstitute/picard/wiki/Command-Line-Syntax-Transition-For-Users-(Pre-Transition)
**********
********** The command line looks like this in the new syntax:
**********
**********    CreateSequenceDictionary -R input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta -O input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.dict
**********


23:39:10.680 INFO  NativeLibraryLoader - Loading libgkl_compression.so from jar:file:/usr/local/share/picard-2.18.27-0/picard.jar!/com/intel/gkl/native/libgkl_compression.so
[Tue Feb 28 23:39:10 GMT 2023] CreateSequenceDictionary OUTPUT=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.dict REFERENCE=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta    TRUNCATE_NAMES_AT_WHITESPACE=true NUM_SEQUENCES=2147483647 VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false GA4GH_CLIENT_SECRETS=client_secrets.json USE_JDK_DEFLATER=false USE_JDK_INFLATER=false
[Tue Feb 28 23:39:10 GMT 2023] Executing as ?@dfee3dc54eee on Linux 3.10.0-1160.36.2.el7.x86_64 amd64; OpenJDK 64-Bit Server VM 11.0.1+13-LTS; Deflater: Intel; Inflater: Intel; Provider GCS is not available; Picard version: 2.18.27-SNAPSHOT
[Tue Feb 28 23:39:11 GMT 2023] picard.sam.CreateSequenceDictionary done. Elapsed time: 0.01 minutes.
Runtime.totalMemory()=2147483648
+ cat
+ mkdir -p output.temp output2
+ read i
+ xargs '-d\n' -I '{}' -P 1 bash -c '{}'
+ ls output/Le1-1-501-701_1.fastq.gz.bam output/Le1-12-501-708_1.fastq.gz.bam output/Le1-13-502-701_1.fastq.gz.bam output/Le1-17-502-703_1.fastq.gz.bam
++ basename output/Le1-1-501-701_1.fastq.gz.bam .bam
+ j=Le1-1-501-701_1.fastq.gz
+ echo -n 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/picard:2.18.27--0  picard -Xmx104857M AddOrReplaceReadGroups I="output/Le1-1-501-701_1.fastq.gz.bam" O=output.temp/"Le1-1-501-701_1.fastq.gz"_addrg.bam SO=coordinate RGID="Le1-1-501-701_1.fastq.gz" RGLB=library RGPL=Illumina RGPU=Illumina RGSM="Le1-1-501-701_1.fastq.gz"; '
+ echo -n '(PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools view -h output.temp/"Le1-1-501-701_1.fastq.gz"_addrg.bam)|bash run-awk-replace.sh|(PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools view -Sb -o output.temp/"Le1-1-501-701_1.fastq.gz"_addrg_repN.bam; '
+ echo -n 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools index output.temp/"Le1-1-501-701_1.fastq.gz"_addrg_repN.bam; '
+ echo 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm broadinstitute/gatk:4.3.0.0  gatk -Xmx104857M SplitNCigarReads -R "input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta" -I output.temp/"Le1-1-501-701_1.fastq.gz"_addrg_repN.bam -O output2/"Le1-1-501-701_1.fastq.gz".bam'
+ read i
++ basename output/Le1-12-501-708_1.fastq.gz.bam .bam
+ j=Le1-12-501-708_1.fastq.gz
+ echo -n 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/picard:2.18.27--0  picard -Xmx104857M AddOrReplaceReadGroups I="output/Le1-12-501-708_1.fastq.gz.bam" O=output.temp/"Le1-12-501-708_1.fastq.gz"_addrg.bam SO=coordinate RGID="Le1-12-501-708_1.fastq.gz" RGLB=library RGPL=Illumina RGPU=Illumina RGSM="Le1-12-501-708_1.fastq.gz"; '
+ echo -n '(PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools view -h output.temp/"Le1-12-501-708_1.fastq.gz"_addrg.bam)|bash run-awk-replace.sh|(PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools view -Sb -o output.temp/"Le1-12-501-708_1.fastq.gz"_addrg_repN.bam; '
+ echo -n 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools index output.temp/"Le1-12-501-708_1.fastq.gz"_addrg_repN.bam; '
+ echo 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm broadinstitute/gatk:4.3.0.0  gatk -Xmx104857M SplitNCigarReads -R "input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta" -I output.temp/"Le1-12-501-708_1.fastq.gz"_addrg_repN.bam -O output2/"Le1-12-501-708_1.fastq.gz".bam'
+ read i
++ basename output/Le1-13-502-701_1.fastq.gz.bam .bam
bash: -c: 行 1: 構文エラー: 予期しないファイル終了 (EOF) です
+ j=Le1-13-502-701_1.fastq.gz
+ echo -n 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/picard:2.18.27--0  picard -Xmx104857M AddOrReplaceReadGroups I="output/Le1-13-502-701_1.fastq.gz.bam" O=output.temp/"Le1-13-502-701_1.fastq.gz"_addrg.bam SO=coordinate RGID="Le1-13-502-701_1.fastq.gz" RGLB=library RGPL=Illumina RGPU=Illumina RGSM="Le1-13-502-701_1.fastq.gz"; '
+ echo -n '(PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools view -h output.temp/"Le1-13-502-701_1.fastq.gz"_addrg.bam)|bash run-awk-replace.sh|(PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools view -Sb -o output.temp/"Le1-13-502-701_1.fastq.gz"_addrg_repN.bam; '
+ echo -n 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools index output.temp/"Le1-13-502-701_1.fastq.gz"_addrg_repN.bam; '
+ echo 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm broadinstitute/gatk:4.3.0.0  gatk -Xmx104857M SplitNCigarReads -R "input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta" -I output.temp/"Le1-13-502-701_1.fastq.gz"_addrg_repN.bam -O output2/"Le1-13-502-701_1.fastq.gz".bam'
+ read i
++ basename output/Le1-17-502-703_1.fastq.gz.bam .bam
bash: -c: 行 1: 構文エラー: 予期しないファイル終了 (EOF) です
+ j=Le1-17-502-703_1.fastq.gz
+ echo -n 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/picard:2.18.27--0  picard -Xmx104857M AddOrReplaceReadGroups I="output/Le1-17-502-703_1.fastq.gz.bam" O=output.temp/"Le1-17-502-703_1.fastq.gz"_addrg.bam SO=coordinate RGID="Le1-17-502-703_1.fastq.gz" RGLB=library RGPL=Illumina RGPU=Illumina RGSM="Le1-17-502-703_1.fastq.gz"; '
+ echo -n '(PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools view -h output.temp/"Le1-17-502-703_1.fastq.gz"_addrg.bam)|bash run-awk-replace.sh|(PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools view -Sb -o output.temp/"Le1-17-502-703_1.fastq.gz"_addrg_repN.bam; '
+ echo -n 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools index output.temp/"Le1-17-502-703_1.fastq.gz"_addrg_repN.bam; '
+ echo 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm broadinstitute/gatk:4.3.0.0  gatk -Xmx104857M SplitNCigarReads -R "input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta" -I output.temp/"Le1-17-502-703_1.fastq.gz"_addrg_repN.bam -O output2/"Le1-17-502-703_1.fastq.gz".bam'
+ read i
bash: -c: 行 1: 構文エラー: 予期しないファイル終了 (EOF) です
bash: -c: 行 1: 構文エラー: 予期しないファイル終了 (EOF) です
++ onerror 62
++ status=123
++ script=/yoshitake/PortablePipeline/PortablePipeline/scripts/RNA-seq~SNPcall-bbmap-callvariants
++ line=62
++ shift
++ set +x

------------------------------------------------------------
Error occured on /yoshitake/PortablePipeline/PortablePipeline/scripts/RNA-seq~SNPcall-bbmap-callvariants [Line 62]: Status 123

PID: 405362
User: yoshitake.kazutoshi
Current directory: /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants
Command line: /yoshitake/PortablePipeline/PortablePipeline/scripts/RNA-seq~SNPcall-bbmap-callvariants 
------------------------------------------------------------

PID: 405360
pp runtime error.
Checking the realpath of input files.
0 input_1/
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-1-501-701_1.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-1-501-701_2.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-12-501-708_1.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-12-501-708_2.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-17-502-703_2.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-13-502-701_2.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-17-502-703_1.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-13-502-701_1.fastq.gz
0 input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
script: /yoshitake/PortablePipeline/PortablePipeline/scripts/RNA-seq~SNPcall-bbmap-callvariants "$scriptdir"/mapping-illumina~bbmap
broadinstitute/gatk:4.3.0.0 centos:centos6 quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1 quay.io/biocontainers/picard:2.18.27--0
using docker
+ set -o pipefail
++ date +%s
+ time0=1677627617
+ echo start at 1677627617
start at 1677627617
++ echo input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
++ grep '[.]gz$'
++ wc -l
++ true
+ '[' 0 = 1 ']'
+ ref=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
++ echo input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
++ sed 's/[.]\(fa\|fasta\|fsa\|fna\)$//'
+ refbase=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg
+ FUNC_RUN_DOCKER quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1 samtools faidx input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
+ PP_RUN_IMAGE=quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1
+ shift
+ PP_RUN_DOCKER_CMD=("${@}")
++ date +%Y%m%d_%H%M%S_%3N
+ PPDOCNAME=pp20230301_084017_338_885
+ echo pp20230301_084017_338_885
++ id -u
++ id -g
+ docker run --name pp20230301_084017_338_885 -v /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants:/yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants -w /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1 samtools faidx input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
+ rm -f input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.dict
+ FUNC_RUN_DOCKER quay.io/biocontainers/picard:2.18.27--0 picard -Xmx104857M CreateSequenceDictionary R=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta O=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.dict
+ PP_RUN_IMAGE=quay.io/biocontainers/picard:2.18.27--0
+ shift
+ PP_RUN_DOCKER_CMD=("${@}")
++ date +%Y%m%d_%H%M%S_%3N
+ PPDOCNAME=pp20230301_084018_231_32683
+ echo pp20230301_084018_231_32683
++ id -u
++ id -g
+ docker run --name pp20230301_084018_231_32683 -v /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants:/yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants -w /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants -u 2007:600 -i --rm quay.io/biocontainers/picard:2.18.27--0 picard -Xmx104857M CreateSequenceDictionary R=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta O=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.dict
/usr/local/bin/picard: line 5: warning: setlocale: LC_ALL: cannot change locale (en_US.UTF-8): No such file or directory
INFO	2023-02-28 23:40:19	CreateSequenceDictionary	

********** NOTE: Picard's command line syntax is changing.
**********
********** For more information, please see:
********** https://github.com/broadinstitute/picard/wiki/Command-Line-Syntax-Transition-For-Users-(Pre-Transition)
**********
********** The command line looks like this in the new syntax:
**********
**********    CreateSequenceDictionary -R input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta -O input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.dict
**********


23:40:20.001 INFO  NativeLibraryLoader - Loading libgkl_compression.so from jar:file:/usr/local/share/picard-2.18.27-0/picard.jar!/com/intel/gkl/native/libgkl_compression.so
[Tue Feb 28 23:40:20 GMT 2023] CreateSequenceDictionary OUTPUT=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.dict REFERENCE=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta    TRUNCATE_NAMES_AT_WHITESPACE=true NUM_SEQUENCES=2147483647 VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false GA4GH_CLIENT_SECRETS=client_secrets.json USE_JDK_DEFLATER=false USE_JDK_INFLATER=false
[Tue Feb 28 23:40:20 GMT 2023] Executing as ?@a530dca5357e on Linux 3.10.0-1160.36.2.el7.x86_64 amd64; OpenJDK 64-Bit Server VM 11.0.1+13-LTS; Deflater: Intel; Inflater: Intel; Provider GCS is not available; Picard version: 2.18.27-SNAPSHOT
[Tue Feb 28 23:40:20 GMT 2023] picard.sam.CreateSequenceDictionary done. Elapsed time: 0.01 minutes.
Runtime.totalMemory()=2147483648
+ cat
+ mkdir -p output.temp output2
+ ls output/Le1-1-501-701_1.fastq.gz.bam output/Le1-12-501-708_1.fastq.gz.bam output/Le1-13-502-701_1.fastq.gz.bam output/Le1-17-502-703_1.fastq.gz.bam
+ read i
+ xargs '-d\n' -I '{}' -P 1 bash -c '{}'
++ basename output/Le1-1-501-701_1.fastq.gz.bam .bam
+ j=Le1-1-501-701_1.fastq.gz
+ echo -n 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/picard:2.18.27--0  picard -Xmx104857M AddOrReplaceReadGroups I="output/Le1-1-501-701_1.fastq.gz.bam" O=output.temp/"Le1-1-501-701_1.fastq.gz"_addrg.bam SO=coordinate RGID="Le1-1-501-701_1.fastq.gz" RGLB=library RGPL=Illumina RGPU=Illumina RGSM="Le1-1-501-701_1.fastq.gz"; '
+ echo -n '(PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools view -h output.temp/"Le1-1-501-701_1.fastq.gz"_addrg.bam)|bash run-awk-replace.sh|(PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools view -Sb -o output.temp/"Le1-1-501-701_1.fastq.gz"_addrg_repN.bam); '
+ echo -n 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools index output.temp/"Le1-1-501-701_1.fastq.gz"_addrg_repN.bam; '
+ echo 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm broadinstitute/gatk:4.3.0.0  gatk -Xmx104857M SplitNCigarReads -R "input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta" -I output.temp/"Le1-1-501-701_1.fastq.gz"_addrg_repN.bam -O output2/"Le1-1-501-701_1.fastq.gz".bam'
+ read i
++ basename output/Le1-12-501-708_1.fastq.gz.bam .bam
+ j=Le1-12-501-708_1.fastq.gz
+ echo -n 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/picard:2.18.27--0  picard -Xmx104857M AddOrReplaceReadGroups I="output/Le1-12-501-708_1.fastq.gz.bam" O=output.temp/"Le1-12-501-708_1.fastq.gz"_addrg.bam SO=coordinate RGID="Le1-12-501-708_1.fastq.gz" RGLB=library RGPL=Illumina RGPU=Illumina RGSM="Le1-12-501-708_1.fastq.gz"; '
+ echo -n '(PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools view -h output.temp/"Le1-12-501-708_1.fastq.gz"_addrg.bam)|bash run-awk-replace.sh|(PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools view -Sb -o output.temp/"Le1-12-501-708_1.fastq.gz"_addrg_repN.bam); '
+ echo -n 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools index output.temp/"Le1-12-501-708_1.fastq.gz"_addrg_repN.bam; '
+ echo 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm broadinstitute/gatk:4.3.0.0  gatk -Xmx104857M SplitNCigarReads -R "input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta" -I output.temp/"Le1-12-501-708_1.fastq.gz"_addrg_repN.bam -O output2/"Le1-12-501-708_1.fastq.gz".bam'
+ read i
++ basename output/Le1-13-502-701_1.fastq.gz.bam .bam
+ j=Le1-13-502-701_1.fastq.gz
+ echo -n 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/picard:2.18.27--0  picard -Xmx104857M AddOrReplaceReadGroups I="output/Le1-13-502-701_1.fastq.gz.bam" O=output.temp/"Le1-13-502-701_1.fastq.gz"_addrg.bam SO=coordinate RGID="Le1-13-502-701_1.fastq.gz" RGLB=library RGPL=Illumina RGPU=Illumina RGSM="Le1-13-502-701_1.fastq.gz"; '
+ echo -n '(PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools view -h output.temp/"Le1-13-502-701_1.fastq.gz"_addrg.bam)|bash run-awk-replace.sh|(PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools view -Sb -o output.temp/"Le1-13-502-701_1.fastq.gz"_addrg_repN.bam); '
+ echo -n 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools index output.temp/"Le1-13-502-701_1.fastq.gz"_addrg_repN.bam; '
+ echo 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm broadinstitute/gatk:4.3.0.0  gatk -Xmx104857M SplitNCigarReads -R "input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta" -I output.temp/"Le1-13-502-701_1.fastq.gz"_addrg_repN.bam -O output2/"Le1-13-502-701_1.fastq.gz".bam'
+ read i
++ basename output/Le1-17-502-703_1.fastq.gz.bam .bam
+ j=Le1-17-502-703_1.fastq.gz
+ echo -n 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/picard:2.18.27--0  picard -Xmx104857M AddOrReplaceReadGroups I="output/Le1-17-502-703_1.fastq.gz.bam" O=output.temp/"Le1-17-502-703_1.fastq.gz"_addrg.bam SO=coordinate RGID="Le1-17-502-703_1.fastq.gz" RGLB=library RGPL=Illumina RGPU=Illumina RGSM="Le1-17-502-703_1.fastq.gz"; '
+ echo -n '(PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools view -h output.temp/"Le1-17-502-703_1.fastq.gz"_addrg.bam)|bash run-awk-replace.sh|(PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools view -Sb -o output.temp/"Le1-17-502-703_1.fastq.gz"_addrg_repN.bam); '
+ echo -n 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools index output.temp/"Le1-17-502-703_1.fastq.gz"_addrg_repN.bam; '
+ echo 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm broadinstitute/gatk:4.3.0.0  gatk -Xmx104857M SplitNCigarReads -R "input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta" -I output.temp/"Le1-17-502-703_1.fastq.gz"_addrg_repN.bam -O output2/"Le1-17-502-703_1.fastq.gz".bam'
+ read i
/usr/local/bin/picard: line 5: warning: setlocale: LC_ALL: cannot change locale (en_US.UTF-8): No such file or directory
INFO	2023-02-28 23:40:21	AddOrReplaceReadGroups	

********** NOTE: Picard's command line syntax is changing.
**********
********** For more information, please see:
********** https://github.com/broadinstitute/picard/wiki/Command-Line-Syntax-Transition-For-Users-(Pre-Transition)
**********
********** The command line looks like this in the new syntax:
**********
**********    AddOrReplaceReadGroups -I output/Le1-1-501-701_1.fastq.gz.bam -O output.temp/Le1-1-501-701_1.fastq.gz_addrg.bam -SO coordinate -RGID Le1-1-501-701_1.fastq.gz -RGLB library -RGPL Illumina -RGPU Illumina -RGSM Le1-1-501-701_1.fastq.gz
**********


23:40:22.113 INFO  NativeLibraryLoader - Loading libgkl_compression.so from jar:file:/usr/local/share/picard-2.18.27-0/picard.jar!/com/intel/gkl/native/libgkl_compression.so
[Tue Feb 28 23:40:22 GMT 2023] AddOrReplaceReadGroups INPUT=output/Le1-1-501-701_1.fastq.gz.bam OUTPUT=output.temp/Le1-1-501-701_1.fastq.gz_addrg.bam SORT_ORDER=coordinate RGID=Le1-1-501-701_1.fastq.gz RGLB=library RGPL=Illumina RGPU=Illumina RGSM=Le1-1-501-701_1.fastq.gz    VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false GA4GH_CLIENT_SECRETS=client_secrets.json USE_JDK_DEFLATER=false USE_JDK_INFLATER=false
[Tue Feb 28 23:40:22 GMT 2023] Executing as ?@1869a7c02967 on Linux 3.10.0-1160.36.2.el7.x86_64 amd64; OpenJDK 64-Bit Server VM 11.0.1+13-LTS; Deflater: Intel; Inflater: Intel; Provider GCS is not available; Picard version: 2.18.27-SNAPSHOT
INFO	2023-02-28 23:40:22	AddOrReplaceReadGroups	Created read-group ID=Le1-1-501-701_1.fastq.gz PL=Illumina LB=library SM=Le1-1-501-701_1.fastq.gz

[Tue Feb 28 23:40:25 GMT 2023] picard.sam.AddOrReplaceReadGroups done. Elapsed time: 0.05 minutes.
Runtime.totalMemory()=2583691264
USAGE:   [-h]

Available Programs:
--------------------------------------------------------------------------------------
Base Calling:                                    Tools that process sequencing machine data, e.g. Illumina base calls, and detect sequencing level attributes, e.g. adapters
    CheckIlluminaDirectory (Picard)              Asserts the validity for specified Illumina basecalling data.  
    CollectIlluminaBasecallingMetrics (Picard)   Collects Illumina Basecalling metrics for a sequencing run.  
    CollectIlluminaLaneMetrics (Picard)          Collects Illumina lane metrics for the given BaseCalling analysis directory.
    ExtractIlluminaBarcodes (Picard)             Tool determines the barcode for each read in an Illumina lane.  
    IlluminaBasecallsToFastq (Picard)            Generate FASTQ file(s) from Illumina basecall read data.  
    IlluminaBasecallsToSam (Picard)              Transforms raw Illumina sequencing data into an unmapped SAM, BAM or CRAM file.
    MarkIlluminaAdapters (Picard)                Reads a SAM/BAM/CRAM file and rewrites it with new adapter-trimming tags.  

--------------------------------------------------------------------------------------
Copy Number Variant Discovery:                   Tools that analyze read coverage to detect copy number variants.
    AnnotateIntervals                            Annotates intervals with GC content, mappability, and segmental-duplication content
    CallCopyRatioSegments                        Calls copy-ratio segments as amplified, deleted, or copy-number neutral
    CombineSegmentBreakpoints                    (EXPERIMENTAL Tool) Combine the breakpoints of two segment files and annotate the resulting intervals with chosen columns from each file.
    CreateReadCountPanelOfNormals                Creates a panel of normals for read-count denoising
    DenoiseReadCounts                            Denoises read counts to produce denoised copy ratios
    DetermineGermlineContigPloidy                Determines the baseline contig ploidy for germline samples given counts data
    FilterIntervals                              Filters intervals based on annotations and/or count statistics
    GermlineCNVCaller                            Calls copy-number variants in germline samples given their counts and the output of DetermineGermlineContigPloidy
    MergeAnnotatedRegions                        (EXPERIMENTAL Tool) Merge annotated genomic regions based entirely on touching/overlapping intervals.
    MergeAnnotatedRegionsByAnnotation            (EXPERIMENTAL Tool) Merge annotated genomic regions within specified distance if annotation value(s) are exactly the same.
    ModelSegments                                Models segmented copy ratios from denoised copy ratios and segmented minor-allele fractions from allelic counts
    PlotDenoisedCopyRatios                       Creates plots of denoised copy ratios
    PlotModeledSegments                          Creates plots of denoised and segmented copy-ratio and minor-allele-fraction estimates
    PostprocessGermlineCNVCalls                  Postprocesses the output of GermlineCNVCaller and generates VCFs and denoised copy ratios
    TagGermlineEvents                            (EXPERIMENTAL Tool) Do a simplistic tagging of germline events in a tumor segment file.

--------------------------------------------------------------------------------------
Coverage Analysis:                               Tools that count coverage, e.g. depth per allele
    ASEReadCounter                               Generates table of filtered base counts at het sites for allele specific expression
    AnalyzeSaturationMutagenesis                 (BETA Tool) (EXPERIMENTAL) Processes reads from a MITESeq or other saturation mutagenesis experiment.
    CollectAllelicCounts                         Collects reference and alternate allele counts at specified sites
    CollectAllelicCountsSpark                    Collects reference and alternate allele counts at specified sites
    CollectF1R2Counts                            Collect F1R2 read counts for the Mutect2 orientation bias mixture model filter
    CollectReadCounts                            Collects read counts at specified intervals
    CountBases                                   Count bases in a SAM/BAM/CRAM file
    CountBasesSpark                              Counts bases in the input SAM/BAM
    CountReads                                   Count reads in a SAM/BAM/CRAM file
    CountReadsSpark                              Counts reads in the input SAM/BAM
    DepthOfCoverage                              (BETA Tool) Generate coverage summary information for reads data
    GatherNormalArtifactData                     Combine output files from GetNormalArtifactData in the order defined by a sequence dictionary
    GeneExpressionEvaluation                     (BETA Tool) Evaluate gene expression from RNA-seq reads aligned to genome.
    GetNormalArtifactData                        Collects data for training normal artifact filter
    GetPileupSummaries                           Tabulates pileup metrics for inferring contamination
    LocalAssembler                               (BETA Tool) Local assembler for SVs
    Pileup                                       Prints read alignments in samtools pileup format
    PileupSpark                                  (BETA Tool) Prints read alignments in samtools pileup format

--------------------------------------------------------------------------------------
Diagnostics and Quality Control:                 Tools that collect sequencing quality related and comparative metrics
    AccumulateQualityYieldMetrics (Picard)       Combines multiple QualityYieldMetrics files into a single file.
    AccumulateVariantCallingMetrics (Picard)     Combines multiple Variant Calling Metrics files into a single file
    AnalyzeCovariates                            Evaluate and compare base quality score recalibration (BQSR) tables
    BamIndexStats (Picard)                       Generate index statistics from a BAM file
    CalcMetadataSpark                            (BETA Tool) (Internal) Collects read metrics relevant to structural variant discovery
    CalculateContamination                       Calculate the fraction of reads coming from cross-sample contamination
    CalculateFingerprintMetrics (Picard)         Calculate statistics on fingerprints, checking their viability
    CalculateReadGroupChecksum (Picard)          Creates a hash code based on the read groups (RG).  
    CheckDuplicateMarking (Picard)               Checks the consistency of duplicate markings.
    CheckFingerprint (Picard)                    Computes a fingerprint from the supplied input (SAM/BAM/CRAM or VCF) file and compares it to the provided genotypes
    CheckPileup                                  Compare GATK's internal pileup to a reference Samtools mpileup
    CheckTerminatorBlock (Picard)                Asserts the provided gzip file's (e.g., BAM) last block is well-formed; RC 100 otherwise
    ClusterCrosscheckMetrics (Picard)            Clusters the results of a CrosscheckFingerprints run by LOD score
    CollectAlignmentSummaryMetrics (Picard)      Produces a summary of alignment metrics from a SAM or BAM file.  
    CollectArraysVariantCallingMetrics (Picard)  Collects summary and per-sample from the provided arrays VCF file
    CollectBaseDistributionByCycle (Picard)      Chart the nucleotide distribution per cycle in a SAM or BAM file
    CollectBaseDistributionByCycleSpark          (BETA Tool) Collects base distribution per cycle in SAM/BAM/CRAM file(s).
    CollectGcBiasMetrics (Picard)                Collect metrics regarding GC bias. 
    CollectHiSeqXPfFailMetrics (Picard)          Classify PF-Failing reads in a HiSeqX Illumina Basecalling directory into various categories.
    CollectHsMetrics (Picard)                    Collects hybrid-selection (HS) metrics for a SAM or BAM file.  
    CollectIndependentReplicateMetrics (Picard)  (EXPERIMENTAL Tool) Estimates the rate of independent replication rate of reads within a bam. 

    CollectInsertSizeMetrics (Picard)            Collect metrics about the insert size distribution of a paired-end library. 
    CollectInsertSizeMetricsSpark                (BETA Tool) Collects insert size distribution information on alignment data
    CollectJumpingLibraryMetrics (Picard)        Collect jumping library metrics. 
    CollectMultipleMetrics (Picard)              Collect multiple classes of metrics. 
    CollectMultipleMetricsSpark                  (BETA Tool) Runs multiple metrics collection modules for a given alignment file
    CollectOxoGMetrics (Picard)                  Collect metrics to assess oxidative artifacts.
    CollectQualityYieldMetrics (Picard)          Collect metrics about reads that pass quality thresholds and Illumina-specific filters.  
    CollectQualityYieldMetricsSpark              (BETA Tool) Collects quality yield metrics from SAM/BAM/CRAM file(s).
    CollectRawWgsMetrics (Picard)                Collect whole genome sequencing-related metrics.  
    CollectRnaSeqMetrics (Picard)                Produces RNA alignment metrics for a SAM or BAM file.  
    CollectRrbsMetrics (Picard)                  Collects metrics from reduced representation bisulfite sequencing (Rrbs) data.  
    CollectSamErrorMetrics (Picard)              Program to collect error metrics on bases stratified in various ways.
    CollectSequencingArtifactMetrics (Picard)    Collect metrics to quantify single-base sequencing artifacts.  
    CollectTargetedPcrMetrics (Picard)           Calculate PCR-related metrics from targeted sequencing data. 
    CollectVariantCallingMetrics (Picard)        Collects per-sample and aggregate (spanning all samples) metrics from the provided VCF file
    CollectWgsMetrics (Picard)                   Collect metrics about coverage and performance of whole genome sequencing (WGS) experiments.
    CollectWgsMetricsWithNonZeroCoverage (Picard)(EXPERIMENTAL Tool) Collect metrics about coverage and performance of whole genome sequencing (WGS) experiments.  
    CompareBaseQualities                         Compares the base qualities of two SAM/BAM/CRAM files
    CompareDuplicatesSpark                       (BETA Tool) Determine if two potentially identical BAMs have the same duplicate reads
    CompareMetrics (Picard)                      Compare two metrics files.
    CompareSAMs (Picard)                         Compare two input SAM/BAM/CRAM files.  
    ConvertHaplotypeDatabaseToVcf (Picard)       Convert Haplotype database file to vcf
    ConvertSequencingArtifactToOxoG (Picard)     Extract OxoG metrics from generalized artifacts metrics.  
    CrosscheckFingerprints (Picard)              Checks that all data in the input files appear to have come from the same individual
    CrosscheckReadGroupFingerprints (Picard)     DEPRECATED: USE CrosscheckFingerprints. 
    DumpTabixIndex                               Dumps a tabix index file.
    EstimateLibraryComplexity (Picard)           Estimates the numbers of unique molecules in a sequencing library.  
    ExtractFingerprint (Picard)                  Computes a fingerprint from the input file.
    FlagStat                                     Accumulate flag statistics given a BAM file
    FlagStatSpark                                Spark tool to accumulate flag statistics
    GatherPileupSummaries                        Combine output files from GetPileupSummary in the order defined by a sequence dictionary
    GetSampleName                                Emit a single sample name
    IdentifyContaminant (Picard)                 Computes a fingerprint from the supplied SAM/BAM file, given a contamination estimate.
    LiftOverHaplotypeMap (Picard)                Lifts over a haplotype database from one reference to another
    MeanQualityByCycle (Picard)                  Collect mean quality by cycle.
    MeanQualityByCycleSpark                      (BETA Tool) MeanQualityByCycle on Spark
    QualityScoreDistribution (Picard)            Chart the distribution of quality scores.  
    QualityScoreDistributionSpark                (BETA Tool) QualityScoreDistribution on Spark
    ValidateSamFile (Picard)                     Validates a SAM/BAM/CRAM file.
    ViewSam (Picard)                             Prints a SAM or BAM file to the screen

--------------------------------------------------------------------------------------
Example Tools:                                   Example tools that show developers how to implement new tools
    ExampleMultiFeatureWalker                    Example of a MultiFeatureWalker subclass.
    HtsgetReader                                 (EXPERIMENTAL Tool) Download a file using htsget

--------------------------------------------------------------------------------------
Flow Based Tools:                                Tools designed specifically to operate on flow based data
    CalculateAverageCombinedAnnotations          (EXPERIMENTAL Tool) Divides annotations that were summed by genomicsDB by number of samples to calculate average.
    FlowFeatureMapper                            (EXPERIMENTAL Tool) Map/find features in BAM file, output VCF. Initially mapping SNVs
    GroundTruthReadsBuilder                      (EXPERIMENTAL Tool) Produces a flexible and robust ground truth set for base calling training
    SplitCRAM                                    (EXPERIMENTAL Tool) Split CRAM files to smaller files efficiently

--------------------------------------------------------------------------------------
Genotyping Arrays Manipulation:                  Tools that manipulate data generated by Genotyping arrays
    BpmToNormalizationManifestCsv (Picard)       Program to convert an Illumina bpm file into a bpm.csv file.
    CombineGenotypingArrayVcfs (Picard)          Program to combine multiple genotyping array VCF files into one VCF.
    CompareGtcFiles (Picard)                     Compares two GTC files.
    CreateBafRegressMetricsFile (Picard)         Program to generate a picard metrics file from the output of the bafRegress tool.
    CreateExtendedIlluminaManifest (Picard)      Create an Extended Illumina Manifest for usage by the Picard tool GtcToVcf
    CreateVerifyIDIntensityContaminationMetricsFile (Picard)    Program to generate a picard metrics file from the output of the VerifyIDIntensity tool.
    GtcToVcf (Picard)                            Program to convert an Illumina GTC file to a VCF
    MergePedIntoVcf (Picard)                     Program to merge a single-sample ped file from zCall into a single-sample VCF.
    VcfToAdpc (Picard)                           Program to convert an Arrays VCF to an ADPC file.

--------------------------------------------------------------------------------------
Intervals Manipulation:                          Tools that process genomic intervals in various formats
    BedToIntervalList (Picard)                   Converts a BED file to a Picard Interval List.  
    CompareIntervalLists                         Compare two interval lists for equality
    IntervalListToBed (Picard)                   Converts an Picard IntervalList file to a BED file.
    IntervalListTools (Picard)                   A tool for performing various IntervalList manipulations
    LiftOverIntervalList (Picard)                Lifts over an interval list from one reference build to another. 
    PreprocessIntervals                          Prepares bins for coverage collection
    SplitIntervals                               Split intervals into sub-interval files.

--------------------------------------------------------------------------------------
Metagenomics:                                    Tools that perform metagenomic analysis, e.g. microbial community composition and pathogen detection
    PathSeqBuildKmers                            Builds set of host reference k-mers
    PathSeqBuildReferenceTaxonomy                Builds a taxonomy datafile of the microbe reference
    PathSeqBwaSpark                              Step 2: Aligns reads to the microbe reference
    PathSeqFilterSpark                           Step 1: Filters low quality, low complexity, duplicate, and host reads
    PathSeqPipelineSpark                         Combined tool that performs all steps: read filtering, microbe reference alignment, and abundance scoring
    PathSeqScoreSpark                            Step 3: Classifies pathogen-aligned reads and generates abundance scores

--------------------------------------------------------------------------------------
Methylation-Specific Tools:                      Tools that perform methylation calling, processing bisulfite sequenced, methylation-aware aligned BAM
    MethylationTypeCaller                        (EXPERIMENTAL Tool) Identify methylated bases from bisulfite sequenced, methylation-aware BAMs

--------------------------------------------------------------------------------------
Other:                                           Miscellaneous tools, e.g. those that aid in data streaming
    CreateHadoopBamSplittingIndex                (BETA Tool) Create a Hadoop BAM splitting index
    FifoBuffer (Picard)                          Provides a large, FIFO buffer that can be used to buffer input and output streams between programs.
    GatherBQSRReports                            Gathers scattered BQSR recalibration reports into a single file
    GatherTranches                               (BETA Tool) Gathers scattered VQSLOD tranches into a single file
    IndexFeatureFile                             Creates an index for a feature file, e.g. VCF or BED file.
    ParallelCopyGCSDirectoryIntoHDFSSpark        (BETA Tool) Parallel copy a file or directory from Google Cloud Storage into the HDFS file system used by Spark
    PrintBGZFBlockInformation                    (EXPERIMENTAL Tool) Print information about the compressed blocks in a BGZF format file
    ReadAnonymizer                               (EXPERIMENTAL Tool) Replace bases in reads with reference bases.
    ReblockGVCF                                  Condenses homRef blocks in a single-sample GVCF
    SortGff (Picard)                             Sorts a gff3 file, and adds flush directives

--------------------------------------------------------------------------------------
Read Data Manipulation:                          Tools that manipulate read data in SAM, BAM or CRAM format
    AddCommentsToBam (Picard)                    Adds comments to the header of a BAM file.
    AddOATag (Picard)                            Record current alignment information to OA tag.
    AddOrReplaceReadGroups (Picard)              Assigns all the reads in a file to a single new read-group.
    AddOriginalAlignmentTags                     (EXPERIMENTAL Tool) Adds Original Alignment tag and original mate contig tag
    ApplyBQSR                                    Apply base quality score recalibration
    ApplyBQSRSpark                               (BETA Tool) Apply base quality score recalibration on Spark
    BQSRPipelineSpark                            (BETA Tool) Both steps of BQSR (BaseRecalibrator and ApplyBQSR) on Spark
    BamToBfq (Picard)                            Converts a BAM file into a BFQ (binary fastq formatted) file
    BaseRecalibrator                             Generates recalibration table for Base Quality Score Recalibration (BQSR)
    BaseRecalibratorSpark                        (BETA Tool) Generate recalibration table for Base Quality Score Recalibration (BQSR) on Spark
    BuildBamIndex (Picard)                       Generates a BAM index ".bai" file.  
    BwaAndMarkDuplicatesPipelineSpark            (BETA Tool) Takes name-sorted file and runs BWA and MarkDuplicates.
    BwaSpark                                     (BETA Tool) Align reads to a given reference using BWA on Spark
    CleanSam (Picard)                            Cleans a SAM/BAM/CRAM files, soft-clipping beyond-end-of-reference alignments and setting MAPQ to 0 for unmapped reads
    ClipReads                                    Clip reads in a SAM/BAM/CRAM file
    CollectDuplicateMetrics (Picard)             Collect Duplicate metrics from marked file.
    ConvertHeaderlessHadoopBamShardToBam         (BETA Tool) Convert a headerless BAM shard into a readable BAM
    DownsampleByDuplicateSet                     (BETA Tool) Discard a set fraction of duplicate sets from a UMI-grouped bam
    DownsampleSam (Picard)                       Downsample a SAM or BAM file.
    ExtractOriginalAlignmentRecordsByNameSpark   (BETA Tool) Subsets reads by name
    FastqToSam (Picard)                          Converts a FASTQ file to an unaligned BAM or SAM file
    FilterSamReads (Picard)                      Subsets reads from a SAM/BAM/CRAM file by applying one of several filters.
    FixMateInformation (Picard)                  Verify mate-pair information between mates and fix if needed.
    FixMisencodedBaseQualityReads                Fix Illumina base quality scores in a SAM/BAM/CRAM file
    GatherBamFiles (Picard)                      Concatenate efficiently BAM files that resulted from a scattered parallel analysis
    LeftAlignIndels                              Left-aligns indels from reads in a SAM/BAM/CRAM file
    MarkDuplicates (Picard)                      Identifies duplicate reads.  
    MarkDuplicatesSpark                          MarkDuplicates on Spark
    MarkDuplicatesWithMateCigar (Picard)         Identifies duplicate reads, accounting for mate CIGAR.  
    MergeBamAlignment (Picard)                   Merge alignment data from a SAM or BAM with data in an unmapped BAM file.  
    MergeSamFiles (Picard)                       Merges multiple SAM/BAM/CRAM (and/or) files into a single file.  
    PositionBasedDownsampleSam (Picard)          Downsample a SAM or BAM file to retain a subset of the reads based on the reads location in each tile in the flowcell.
    PostProcessReadsForRSEM                      (BETA Tool) Reorder reads before running RSEM
    PrintDistantMates                            Unmaps reads with distant mates.
    PrintReads                                   Print reads in the SAM/BAM/CRAM file
    PrintReadsHeader                             Print the header from a SAM/BAM/CRAM file
    PrintReadsSpark                              PrintReads on Spark
    ReorderSam (Picard)                          Reorders reads in a SAM or BAM file to match ordering in a second reference file.
    ReplaceSamHeader (Picard)                    Replaces the SAMFileHeader in a SAM/BAM/CRAM file.  
    RevertBaseQualityScores                      Revert Quality Scores in a SAM/BAM/CRAM file
    RevertOriginalBaseQualitiesAndAddMateCigar (Picard)Reverts the original base qualities and adds the mate cigar tag to read-group files
    RevertSam (Picard)                           Reverts SAM/BAM/CRAM files to a previous state.  
    RevertSamSpark                               (BETA Tool) Reverts SAM, BAM or CRAM files to a previous state.
    SamFormatConverter (Picard)                  Convert a BAM file to a SAM file, or a SAM to a BAM
    SamToFastq (Picard)                          Converts a SAM/BAM/CRAM file to FASTQ.
    SamToFastqWithTags (Picard)                  Converts a SAM or BAM file to FASTQ alongside FASTQs created from tags.
    SetNmAndUqTags (Picard)                      DEPRECATED: Use SetNmMdAndUqTags instead.
    SetNmMdAndUqTags (Picard)                    Fixes the NM, MD, and UQ tags in a SAM/BAM/CRAM file 
    SimpleMarkDuplicatesWithMateCigar (Picard)   (EXPERIMENTAL Tool) Examines aligned records in the supplied SAM or BAM file to locate duplicate molecules.
    SortSam (Picard)                             Sorts a SAM, BAM or CRAM file.  
    SortSamSpark                                 (BETA Tool) SortSam on Spark (works on SAM/BAM/CRAM)
    SplitNCigarReads                             Split Reads with N in Cigar
    SplitReads                                   Outputs reads from a SAM/BAM/CRAM by read group, sample and library name
    SplitSamByLibrary (Picard)                   Splits a SAM/BAM/CRAM file into individual files by library
    SplitSamByNumberOfReads (Picard)             Splits a SAM/BAM/CRAM file to multiple files.
    TransferReadTags                             (EXPERIMENTAL Tool) Incorporate read tags in a SAM file to that of a matching SAM file
    UmiAwareMarkDuplicatesWithMateCigar (Picard) (EXPERIMENTAL Tool) Identifies duplicate reads using information from read positions and UMIs. 
    UnmarkDuplicates                             Clears the 0x400 duplicate SAM flag

--------------------------------------------------------------------------------------
Reference:                                       Tools that analyze and manipulate FASTA format references
    BaitDesigner (Picard)                        Designs oligonucleotide baits for hybrid selection reactions.
    BwaMemIndexImageCreator                      Create a BWA-MEM index image file for use with GATK BWA tools
    CheckReferenceCompatibility                  (EXPERIMENTAL Tool) Check a BAM/VCF for compatibility against specified references.
    CompareReferences                            (EXPERIMENTAL Tool) Display reference comparison as a tab-delimited table and summarize reference differences.
    ComposeSTRTableFile                          Composes a genome-wide STR location table used for DragSTR model auto-calibration
    CountBasesInReference                        Count the numbers of each base in a reference file
    CreateSequenceDictionary (Picard)            Creates a sequence dictionary for a reference sequence.  
    ExtractSequences (Picard)                    Subsets intervals from a reference sequence to a new FASTA file.
    FastaAlternateReferenceMaker                 Create an alternative reference by combining a fasta with a vcf.
    FastaReferenceMaker                          Create snippets of a fasta file
    FindBadGenomicKmersSpark                     (BETA Tool) Identifies sequences that occur at high frequency in a reference
    NonNFastaSize (Picard)                       Counts the number of non-N bases in a fasta file.
    NormalizeFasta (Picard)                      Normalizes lines of sequence in a FASTA file to be of the same length.
    ScatterIntervalsByNs (Picard)                Writes an interval list created by splitting a reference at Ns.
    ShiftFasta                                   (BETA Tool) Creates a shifted fasta file and shift_back file

--------------------------------------------------------------------------------------
Short Variant Discovery:                         Tools that perform variant calling and genotyping for short variants (SNPs, SNVs and Indels)
    CalibrateDragstrModel                        estimates the parameters for the DRAGstr model
    CombineGVCFs                                 Merges one or more HaplotypeCaller GVCF files into a single GVCF with appropriate annotations
    GenomicsDBImport                             Import VCFs to GenomicsDB
    GenotypeGVCFs                                Perform joint genotyping on one or more samples pre-called with HaplotypeCaller
    GnarlyGenotyper                              (BETA Tool) Perform "quick and dirty" joint genotyping on one or more samples pre-called with HaplotypeCaller
    HaplotypeBasedVariantRecaller                (EXPERIMENTAL Tool) Calculate likelihood matrix for each Allele in VCF against a set of Reads limited by a set of Haplotypes
    HaplotypeCaller                              Call germline SNPs and indels via local re-assembly of haplotypes
    HaplotypeCallerSpark                         (BETA Tool) HaplotypeCaller on Spark
    LearnReadOrientationModel                    Get the maximum likelihood estimates of artifact prior probabilities in the orientation bias mixture model filter
    MergeMutectStats                             Merge the stats output by scatters of a single Mutect2 job
    Mutect2                                      Call somatic SNVs and indels via local assembly of haplotypes
    RampedHaplotypeCaller                        (EXPERIMENTAL Tool) Call germline SNPs and indels via local re-assembly of haplotypes (ramped version)
    ReadsPipelineSpark                           (BETA Tool) Runs BWA (if specified), MarkDuplicates, BQSR, and HaplotypeCaller on unaligned or aligned reads to generate a VCF.

--------------------------------------------------------------------------------------
Structural Variant Discovery:                    Tools that detect structural variants        
    CollectSVEvidence                            (BETA Tool) Gathers paired-end and split read evidence files for use in the GATK-SV pipeline.
    CondenseDepthEvidence                        (EXPERIMENTAL Tool) Merges adjacent DepthEvidence records.
    CpxVariantReInterpreterSpark                 (BETA Tool) (Internal) Tries to extract simple variants from a provided GATK-SV CPX.vcf
    DiscoverVariantsFromContigAlignmentsSAMSpark (BETA Tool) (Internal) Examines aligned contigs from local assemblies and calls structural variants
    ExtractSVEvidenceSpark                       (BETA Tool) (Internal) Extracts evidence of structural variations from reads
    FindBreakpointEvidenceSpark                  (BETA Tool) (Internal) Produces local assemblies of genomic regions that may harbor structural variants
    JointGermlineCNVSegmentation                 (BETA Tool) Combine segmented gCNV VCFs.
    PrintReadCounts                              (EXPERIMENTAL Tool) Prints count files for CNV determination.
    PrintSVEvidence                              (EXPERIMENTAL Tool) Merges SV evidence records.
    SVAnnotate                                   Adds gene overlap and variant consequence annotations to SV VCF from GATK-SV pipeline
    SVCluster                                    (BETA Tool) Clusters structural variants
    SiteDepthtoBAF                               (EXPERIMENTAL Tool) Convert SiteDepth to BafEvidence
    StructuralVariantDiscoverer                  (BETA Tool) (Internal) Examines aligned contigs from local assemblies and calls structural variants or their breakpoints
    StructuralVariationDiscoveryPipelineSpark    (BETA Tool) Runs the structural variation discovery workflow on a single sample
    SvDiscoverFromLocalAssemblyContigAlignmentsSpark    (BETA Tool) (Internal) Examines aligned contigs from local assemblies and calls structural variants or their breakpoints

--------------------------------------------------------------------------------------
Variant Evaluation and Refinement:               Tools that evaluate and refine variant calls, e.g. with annotations not offered by the engine
    AlleleFrequencyQC                            (BETA Tool) General-purpose tool for variant evaluation (% in dbSNP, genotype concordance, Ti/Tv ratios, and a lot more)
    AnnotateVcfWithBamDepth                      (Internal) Annotate a vcf with a bam's read depth at each variant locus
    AnnotateVcfWithExpectedAlleleFraction        (Internal) Annotate a vcf with expected allele fractions in pooled sequencing
    CalculateGenotypePosteriors                  Calculate genotype posterior probabilities given family and/or known population genotypes
    CalculateMixingFractions                     (Internal) Calculate proportions of different samples in a pooled bam
    Concordance                                  Evaluate concordance of an input VCF against a validated truth VCF
    CountFalsePositives                          (BETA Tool) Count PASS variants
    CountVariants                                Counts variant records in a VCF file, regardless of filter status.
    CountVariantsSpark                           CountVariants on Spark
    EvaluateInfoFieldConcordance                 (BETA Tool) Evaluate concordance of info fields in an input VCF against a validated truth VCF
    FilterFuncotations                           (EXPERIMENTAL Tool) Filter variants based on clinically-significant Funcotations.
    FindMendelianViolations (Picard)             Finds mendelian violations of all types within a VCF
    FuncotateSegments                            (BETA Tool) Functional annotation for segment files.  The output formats are not well-defined and subject to change.
    Funcotator                                   Functional Annotator
    FuncotatorDataSourceDownloader               Data source downloader for Funcotator.
    GenotypeConcordance (Picard)                 Calculates the concordance between genotype data of one sample in each of two VCFs - truth (or reference) vs. calls.
    MergeMutect2CallsWithMC3                     (EXPERIMENTAL Tool) UNSUPPORTED.  FOR EVALUATION ONLY. Merge M2 calls with MC
    ReferenceBlockConcordance                    Evaluate GVCF reference block concordance of an input GVCF against a truth GVCF
    ValidateBasicSomaticShortMutations           (EXPERIMENTAL Tool) Check variants against tumor-normal bams representing the same samples, though not the ones from the actual calls.
    ValidateVariants                             Validate VCF
    VariantEval                                  (BETA Tool) General-purpose tool for variant evaluation (% in dbSNP, genotype concordance, Ti/Tv ratios, and a lot more)
    VariantsToTable                              Extract fields from a VCF file to a tab-delimited table

--------------------------------------------------------------------------------------
Variant Filtering:                               Tools that filter variants by annotating the FILTER column
    ApplyVQSR                                     Apply a score cutoff to filter variants based on a recalibration table
    CNNScoreVariants                             Apply a Convolutional Neural Net to filter annotated variants
    CNNVariantTrain                              (EXPERIMENTAL Tool) Train a CNN model for filtering variants
    CNNVariantWriteTensors                       (EXPERIMENTAL Tool) Write variant tensors for training a CNN to filter variants
    CreateSomaticPanelOfNormals                  (BETA Tool) Make a panel of normals for use with Mutect2
    ExtractVariantAnnotations                    (BETA Tool) Extracts site-level variant annotations, labels, and other metadata from a VCF file to HDF5 files
    FilterAlignmentArtifacts                     (EXPERIMENTAL Tool) Filter alignment artifacts from a vcf callset.
    FilterMutectCalls                            Filter somatic SNVs and indels called by Mutect2
    FilterVariantTranches                        Apply tranche filtering
    FilterVcf (Picard)                           Hard filters a VCF.
    MTLowHeteroplasmyFilterTool                  If too many low het sites, filter all low het sites
    NuMTFilterTool                               Uses the median autosomal coverage and the allele depth to determine whether the allele might be a NuMT
    ScoreVariantAnnotations                      (BETA Tool) Scores variant calls in a VCF file based on site-level annotations using a previously trained model
    TrainVariantAnnotationsModel                 (BETA Tool) Trains a model for scoring variant calls based on site-level annotations
    VariantFiltration                            Filter variant calls based on INFO and/or FORMAT annotations
    VariantRecalibrator                          Build a recalibration model to score variant quality for filtering purposes

--------------------------------------------------------------------------------------
Variant Manipulation:                            Tools that manipulate variant call format (VCF) data
    FixVcfHeader (Picard)                        Replaces or fixes a VCF header.
    GatherVcfs (Picard)                          Gathers multiple VCF files from a scatter operation into a single VCF file
    GatherVcfsCloud                              (BETA Tool) Gathers multiple VCF files from a scatter operation into a single VCF file
    LeftAlignAndTrimVariants                     Left align and trim vairants
    LiftoverVcf (Picard)                         Lifts over a VCF file from one reference build to another.  
    MakeSitesOnlyVcf (Picard)                    Creates a VCF that contains all the site-level information for all records in the input VCF but no genotype information.
    MakeVcfSampleNameMap (Picard)                Creates a TSV from sample name to VCF/GVCF path, with one line per input.
    MergeVcfs (Picard)                           Combines multiple variant files into a single variant file
    PrintVariantsSpark                           Prints out variants from the input VCF.
    RemoveNearbyIndels                           (Internal) Remove indels from the VCF file that are close to each other.
    RenameSampleInVcf (Picard)                   Renames a sample within a VCF or BCF.
    SelectVariants                               Select a subset of variants from a VCF file
    SortVcf (Picard)                             Sorts one or more VCF files.  
    SplitVcfs (Picard)                           Splits SNPs and INDELs into separate files.  
    UpdateVCFSequenceDictionary                  Updates the sequence dictionary in a variant file.
    UpdateVcfSequenceDictionary (Picard)         Takes a VCF and a second file that contains a sequence dictionary and updates the VCF with the new sequence dictionary.
    VariantAnnotator                             Tool for adding annotations to VCF files
    VcfFormatConverter (Picard)                  Converts VCF to BCF or BCF to VCF.  
    VcfToIntervalList (Picard)                   Converts a VCF or BCF file to a Picard Interval List

--------------------------------------------------------------------------------------

***********************************************************************

A USER ERROR has occurred: '-Xmx104857M' is not a valid command.


***********************************************************************
Set the system property GATK_STACKTRACE_ON_USER_EXCEPTION (--java-options '-DGATK_STACKTRACE_ON_USER_EXCEPTION=true') to print the stack trace.
Using GATK jar /gatk/gatk-package-4.3.0.0-local.jar
Running:
    java -Dsamjdk.use_async_io_read_samtools=false -Dsamjdk.use_async_io_write_samtools=true -Dsamjdk.use_async_io_write_tribble=false -Dsamjdk.compression_level=2 -jar /gatk/gatk-package-4.3.0.0-local.jar -Xmx104857M SplitNCigarReads -R input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta -I output.temp/Le1-1-501-701_1.fastq.gz_addrg_repN.bam -O output2/Le1-1-501-701_1.fastq.gz.bam
/usr/local/bin/picard: line 5: warning: setlocale: LC_ALL: cannot change locale (en_US.UTF-8): No such file or directory
INFO	2023-02-28 23:40:33	AddOrReplaceReadGroups	

********** NOTE: Picard's command line syntax is changing.
**********
********** For more information, please see:
********** https://github.com/broadinstitute/picard/wiki/Command-Line-Syntax-Transition-For-Users-(Pre-Transition)
**********
********** The command line looks like this in the new syntax:
**********
**********    AddOrReplaceReadGroups -I output/Le1-12-501-708_1.fastq.gz.bam -O output.temp/Le1-12-501-708_1.fastq.gz_addrg.bam -SO coordinate -RGID Le1-12-501-708_1.fastq.gz -RGLB library -RGPL Illumina -RGPU Illumina -RGSM Le1-12-501-708_1.fastq.gz
**********


23:40:34.049 INFO  NativeLibraryLoader - Loading libgkl_compression.so from jar:file:/usr/local/share/picard-2.18.27-0/picard.jar!/com/intel/gkl/native/libgkl_compression.so
[Tue Feb 28 23:40:34 GMT 2023] AddOrReplaceReadGroups INPUT=output/Le1-12-501-708_1.fastq.gz.bam OUTPUT=output.temp/Le1-12-501-708_1.fastq.gz_addrg.bam SORT_ORDER=coordinate RGID=Le1-12-501-708_1.fastq.gz RGLB=library RGPL=Illumina RGPU=Illumina RGSM=Le1-12-501-708_1.fastq.gz    VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false GA4GH_CLIENT_SECRETS=client_secrets.json USE_JDK_DEFLATER=false USE_JDK_INFLATER=false
[Tue Feb 28 23:40:34 GMT 2023] Executing as ?@04a734825eac on Linux 3.10.0-1160.36.2.el7.x86_64 amd64; OpenJDK 64-Bit Server VM 11.0.1+13-LTS; Deflater: Intel; Inflater: Intel; Provider GCS is not available; Picard version: 2.18.27-SNAPSHOT
INFO	2023-02-28 23:40:34	AddOrReplaceReadGroups	Created read-group ID=Le1-12-501-708_1.fastq.gz PL=Illumina LB=library SM=Le1-12-501-708_1.fastq.gz

[Tue Feb 28 23:40:34 GMT 2023] picard.sam.AddOrReplaceReadGroups done. Elapsed time: 0.01 minutes.
Runtime.totalMemory()=2147483648
USAGE:   [-h]

Available Programs:
--------------------------------------------------------------------------------------
Base Calling:                                    Tools that process sequencing machine data, e.g. Illumina base calls, and detect sequencing level attributes, e.g. adapters
    CheckIlluminaDirectory (Picard)              Asserts the validity for specified Illumina basecalling data.  
    CollectIlluminaBasecallingMetrics (Picard)   Collects Illumina Basecalling metrics for a sequencing run.  
    CollectIlluminaLaneMetrics (Picard)          Collects Illumina lane metrics for the given BaseCalling analysis directory.
    ExtractIlluminaBarcodes (Picard)             Tool determines the barcode for each read in an Illumina lane.  
    IlluminaBasecallsToFastq (Picard)            Generate FASTQ file(s) from Illumina basecall read data.  
    IlluminaBasecallsToSam (Picard)              Transforms raw Illumina sequencing data into an unmapped SAM, BAM or CRAM file.
    MarkIlluminaAdapters (Picard)                Reads a SAM/BAM/CRAM file and rewrites it with new adapter-trimming tags.  

--------------------------------------------------------------------------------------
Copy Number Variant Discovery:                   Tools that analyze read coverage to detect copy number variants.
    AnnotateIntervals                            Annotates intervals with GC content, mappability, and segmental-duplication content
    CallCopyRatioSegments                        Calls copy-ratio segments as amplified, deleted, or copy-number neutral
    CombineSegmentBreakpoints                    (EXPERIMENTAL Tool) Combine the breakpoints of two segment files and annotate the resulting intervals with chosen columns from each file.
    CreateReadCountPanelOfNormals                Creates a panel of normals for read-count denoising
    DenoiseReadCounts                            Denoises read counts to produce denoised copy ratios
    DetermineGermlineContigPloidy                Determines the baseline contig ploidy for germline samples given counts data
    FilterIntervals                              Filters intervals based on annotations and/or count statistics
    GermlineCNVCaller                            Calls copy-number variants in germline samples given their counts and the output of DetermineGermlineContigPloidy
    MergeAnnotatedRegions                        (EXPERIMENTAL Tool) Merge annotated genomic regions based entirely on touching/overlapping intervals.
    MergeAnnotatedRegionsByAnnotation            (EXPERIMENTAL Tool) Merge annotated genomic regions within specified distance if annotation value(s) are exactly the same.
    ModelSegments                                Models segmented copy ratios from denoised copy ratios and segmented minor-allele fractions from allelic counts
    PlotDenoisedCopyRatios                       Creates plots of denoised copy ratios
    PlotModeledSegments                          Creates plots of denoised and segmented copy-ratio and minor-allele-fraction estimates
    PostprocessGermlineCNVCalls                  Postprocesses the output of GermlineCNVCaller and generates VCFs and denoised copy ratios
    TagGermlineEvents                            (EXPERIMENTAL Tool) Do a simplistic tagging of germline events in a tumor segment file.

--------------------------------------------------------------------------------------
Coverage Analysis:                               Tools that count coverage, e.g. depth per allele
    ASEReadCounter                               Generates table of filtered base counts at het sites for allele specific expression
    AnalyzeSaturationMutagenesis                 (BETA Tool) (EXPERIMENTAL) Processes reads from a MITESeq or other saturation mutagenesis experiment.
    CollectAllelicCounts                         Collects reference and alternate allele counts at specified sites
    CollectAllelicCountsSpark                    Collects reference and alternate allele counts at specified sites
    CollectF1R2Counts                            Collect F1R2 read counts for the Mutect2 orientation bias mixture model filter
    CollectReadCounts                            Collects read counts at specified intervals
    CountBases                                   Count bases in a SAM/BAM/CRAM file
    CountBasesSpark                              Counts bases in the input SAM/BAM
    CountReads                                   Count reads in a SAM/BAM/CRAM file
    CountReadsSpark                              Counts reads in the input SAM/BAM
    DepthOfCoverage                              (BETA Tool) Generate coverage summary information for reads data
    GatherNormalArtifactData                     Combine output files from GetNormalArtifactData in the order defined by a sequence dictionary
    GeneExpressionEvaluation                     (BETA Tool) Evaluate gene expression from RNA-seq reads aligned to genome.
    GetNormalArtifactData                        Collects data for training normal artifact filter
    GetPileupSummaries                           Tabulates pileup metrics for inferring contamination
    LocalAssembler                               (BETA Tool) Local assembler for SVs
    Pileup                                       Prints read alignments in samtools pileup format
    PileupSpark                                  (BETA Tool) Prints read alignments in samtools pileup format

--------------------------------------------------------------------------------------
Diagnostics and Quality Control:                 Tools that collect sequencing quality related and comparative metrics
    AccumulateQualityYieldMetrics (Picard)       Combines multiple QualityYieldMetrics files into a single file.
    AccumulateVariantCallingMetrics (Picard)     Combines multiple Variant Calling Metrics files into a single file
    AnalyzeCovariates                            Evaluate and compare base quality score recalibration (BQSR) tables
    BamIndexStats (Picard)                       Generate index statistics from a BAM file
    CalcMetadataSpark                            (BETA Tool) (Internal) Collects read metrics relevant to structural variant discovery
    CalculateContamination                       Calculate the fraction of reads coming from cross-sample contamination
    CalculateFingerprintMetrics (Picard)         Calculate statistics on fingerprints, checking their viability
    CalculateReadGroupChecksum (Picard)          Creates a hash code based on the read groups (RG).  
    CheckDuplicateMarking (Picard)               Checks the consistency of duplicate markings.
    CheckFingerprint (Picard)                    Computes a fingerprint from the supplied input (SAM/BAM/CRAM or VCF) file and compares it to the provided genotypes
    CheckPileup                                  Compare GATK's internal pileup to a reference Samtools mpileup
    CheckTerminatorBlock (Picard)                Asserts the provided gzip file's (e.g., BAM) last block is well-formed; RC 100 otherwise
    ClusterCrosscheckMetrics (Picard)            Clusters the results of a CrosscheckFingerprints run by LOD score
    CollectAlignmentSummaryMetrics (Picard)      Produces a summary of alignment metrics from a SAM or BAM file.  
    CollectArraysVariantCallingMetrics (Picard)  Collects summary and per-sample from the provided arrays VCF file
    CollectBaseDistributionByCycle (Picard)      Chart the nucleotide distribution per cycle in a SAM or BAM file
    CollectBaseDistributionByCycleSpark          (BETA Tool) Collects base distribution per cycle in SAM/BAM/CRAM file(s).
    CollectGcBiasMetrics (Picard)                Collect metrics regarding GC bias. 
    CollectHiSeqXPfFailMetrics (Picard)          Classify PF-Failing reads in a HiSeqX Illumina Basecalling directory into various categories.
    CollectHsMetrics (Picard)                    Collects hybrid-selection (HS) metrics for a SAM or BAM file.  
    CollectIndependentReplicateMetrics (Picard)  (EXPERIMENTAL Tool) Estimates the rate of independent replication rate of reads within a bam. 

    CollectInsertSizeMetrics (Picard)            Collect metrics about the insert size distribution of a paired-end library. 
    CollectInsertSizeMetricsSpark                (BETA Tool) Collects insert size distribution information on alignment data
    CollectJumpingLibraryMetrics (Picard)        Collect jumping library metrics. 
    CollectMultipleMetrics (Picard)              Collect multiple classes of metrics. 
    CollectMultipleMetricsSpark                  (BETA Tool) Runs multiple metrics collection modules for a given alignment file
    CollectOxoGMetrics (Picard)                  Collect metrics to assess oxidative artifacts.
    CollectQualityYieldMetrics (Picard)          Collect metrics about reads that pass quality thresholds and Illumina-specific filters.  
    CollectQualityYieldMetricsSpark              (BETA Tool) Collects quality yield metrics from SAM/BAM/CRAM file(s).
    CollectRawWgsMetrics (Picard)                Collect whole genome sequencing-related metrics.  
    CollectRnaSeqMetrics (Picard)                Produces RNA alignment metrics for a SAM or BAM file.  
    CollectRrbsMetrics (Picard)                  Collects metrics from reduced representation bisulfite sequencing (Rrbs) data.  
    CollectSamErrorMetrics (Picard)              Program to collect error metrics on bases stratified in various ways.
    CollectSequencingArtifactMetrics (Picard)    Collect metrics to quantify single-base sequencing artifacts.  
    CollectTargetedPcrMetrics (Picard)           Calculate PCR-related metrics from targeted sequencing data. 
    CollectVariantCallingMetrics (Picard)        Collects per-sample and aggregate (spanning all samples) metrics from the provided VCF file
    CollectWgsMetrics (Picard)                   Collect metrics about coverage and performance of whole genome sequencing (WGS) experiments.
    CollectWgsMetricsWithNonZeroCoverage (Picard)(EXPERIMENTAL Tool) Collect metrics about coverage and performance of whole genome sequencing (WGS) experiments.  
    CompareBaseQualities                         Compares the base qualities of two SAM/BAM/CRAM files
    CompareDuplicatesSpark                       (BETA Tool) Determine if two potentially identical BAMs have the same duplicate reads
    CompareMetrics (Picard)                      Compare two metrics files.
    CompareSAMs (Picard)                         Compare two input SAM/BAM/CRAM files.  
    ConvertHaplotypeDatabaseToVcf (Picard)       Convert Haplotype database file to vcf
    ConvertSequencingArtifactToOxoG (Picard)     Extract OxoG metrics from generalized artifacts metrics.  
    CrosscheckFingerprints (Picard)              Checks that all data in the input files appear to have come from the same individual
    CrosscheckReadGroupFingerprints (Picard)     DEPRECATED: USE CrosscheckFingerprints. 
    DumpTabixIndex                               Dumps a tabix index file.
    EstimateLibraryComplexity (Picard)           Estimates the numbers of unique molecules in a sequencing library.  
    ExtractFingerprint (Picard)                  Computes a fingerprint from the input file.
    FlagStat                                     Accumulate flag statistics given a BAM file
    FlagStatSpark                                Spark tool to accumulate flag statistics
    GatherPileupSummaries                        Combine output files from GetPileupSummary in the order defined by a sequence dictionary
    GetSampleName                                Emit a single sample name
    IdentifyContaminant (Picard)                 Computes a fingerprint from the supplied SAM/BAM file, given a contamination estimate.
    LiftOverHaplotypeMap (Picard)                Lifts over a haplotype database from one reference to another
    MeanQualityByCycle (Picard)                  Collect mean quality by cycle.
    MeanQualityByCycleSpark                      (BETA Tool) MeanQualityByCycle on Spark
    QualityScoreDistribution (Picard)            Chart the distribution of quality scores.  
    QualityScoreDistributionSpark                (BETA Tool) QualityScoreDistribution on Spark
    ValidateSamFile (Picard)                     Validates a SAM/BAM/CRAM file.
    ViewSam (Picard)                             Prints a SAM or BAM file to the screen

--------------------------------------------------------------------------------------
Example Tools:                                   Example tools that show developers how to implement new tools
    ExampleMultiFeatureWalker                    Example of a MultiFeatureWalker subclass.
    HtsgetReader                                 (EXPERIMENTAL Tool) Download a file using htsget

--------------------------------------------------------------------------------------
Flow Based Tools:                                Tools designed specifically to operate on flow based data
    CalculateAverageCombinedAnnotations          (EXPERIMENTAL Tool) Divides annotations that were summed by genomicsDB by number of samples to calculate average.
    FlowFeatureMapper                            (EXPERIMENTAL Tool) Map/find features in BAM file, output VCF. Initially mapping SNVs
    GroundTruthReadsBuilder                      (EXPERIMENTAL Tool) Produces a flexible and robust ground truth set for base calling training
    SplitCRAM                                    (EXPERIMENTAL Tool) Split CRAM files to smaller files efficiently

--------------------------------------------------------------------------------------
Genotyping Arrays Manipulation:                  Tools that manipulate data generated by Genotyping arrays
    BpmToNormalizationManifestCsv (Picard)       Program to convert an Illumina bpm file into a bpm.csv file.
    CombineGenotypingArrayVcfs (Picard)          Program to combine multiple genotyping array VCF files into one VCF.
    CompareGtcFiles (Picard)                     Compares two GTC files.
    CreateBafRegressMetricsFile (Picard)         Program to generate a picard metrics file from the output of the bafRegress tool.
    CreateExtendedIlluminaManifest (Picard)      Create an Extended Illumina Manifest for usage by the Picard tool GtcToVcf
    CreateVerifyIDIntensityContaminationMetricsFile (Picard)    Program to generate a picard metrics file from the output of the VerifyIDIntensity tool.
    GtcToVcf (Picard)                            Program to convert an Illumina GTC file to a VCF
    MergePedIntoVcf (Picard)                     Program to merge a single-sample ped file from zCall into a single-sample VCF.
    VcfToAdpc (Picard)                           Program to convert an Arrays VCF to an ADPC file.

--------------------------------------------------------------------------------------
Intervals Manipulation:                          Tools that process genomic intervals in various formats
    BedToIntervalList (Picard)                   Converts a BED file to a Picard Interval List.  
    CompareIntervalLists                         Compare two interval lists for equality
    IntervalListToBed (Picard)                   Converts an Picard IntervalList file to a BED file.
    IntervalListTools (Picard)                   A tool for performing various IntervalList manipulations
    LiftOverIntervalList (Picard)                Lifts over an interval list from one reference build to another. 
    PreprocessIntervals                          Prepares bins for coverage collection
    SplitIntervals                               Split intervals into sub-interval files.

--------------------------------------------------------------------------------------
Metagenomics:                                    Tools that perform metagenomic analysis, e.g. microbial community composition and pathogen detection
    PathSeqBuildKmers                            Builds set of host reference k-mers
    PathSeqBuildReferenceTaxonomy                Builds a taxonomy datafile of the microbe reference
    PathSeqBwaSpark                              Step 2: Aligns reads to the microbe reference
    PathSeqFilterSpark                           Step 1: Filters low quality, low complexity, duplicate, and host reads
    PathSeqPipelineSpark                         Combined tool that performs all steps: read filtering, microbe reference alignment, and abundance scoring
    PathSeqScoreSpark                            Step 3: Classifies pathogen-aligned reads and generates abundance scores

--------------------------------------------------------------------------------------
Methylation-Specific Tools:                      Tools that perform methylation calling, processing bisulfite sequenced, methylation-aware aligned BAM
    MethylationTypeCaller                        (EXPERIMENTAL Tool) Identify methylated bases from bisulfite sequenced, methylation-aware BAMs

--------------------------------------------------------------------------------------
Other:                                           Miscellaneous tools, e.g. those that aid in data streaming
    CreateHadoopBamSplittingIndex                (BETA Tool) Create a Hadoop BAM splitting index
    FifoBuffer (Picard)                          Provides a large, FIFO buffer that can be used to buffer input and output streams between programs.
    GatherBQSRReports                            Gathers scattered BQSR recalibration reports into a single file
    GatherTranches                               (BETA Tool) Gathers scattered VQSLOD tranches into a single file
    IndexFeatureFile                             Creates an index for a feature file, e.g. VCF or BED file.
    ParallelCopyGCSDirectoryIntoHDFSSpark        (BETA Tool) Parallel copy a file or directory from Google Cloud Storage into the HDFS file system used by Spark
    PrintBGZFBlockInformation                    (EXPERIMENTAL Tool) Print information about the compressed blocks in a BGZF format file
    ReadAnonymizer                               (EXPERIMENTAL Tool) Replace bases in reads with reference bases.
    ReblockGVCF                                  Condenses homRef blocks in a single-sample GVCF
    SortGff (Picard)                             Sorts a gff3 file, and adds flush directives

--------------------------------------------------------------------------------------
Read Data Manipulation:                          Tools that manipulate read data in SAM, BAM or CRAM format
    AddCommentsToBam (Picard)                    Adds comments to the header of a BAM file.
    AddOATag (Picard)                            Record current alignment information to OA tag.
    AddOrReplaceReadGroups (Picard)              Assigns all the reads in a file to a single new read-group.
    AddOriginalAlignmentTags                     (EXPERIMENTAL Tool) Adds Original Alignment tag and original mate contig tag
    ApplyBQSR                                    Apply base quality score recalibration
    ApplyBQSRSpark                               (BETA Tool) Apply base quality score recalibration on Spark
    BQSRPipelineSpark                            (BETA Tool) Both steps of BQSR (BaseRecalibrator and ApplyBQSR) on Spark
    BamToBfq (Picard)                            Converts a BAM file into a BFQ (binary fastq formatted) file
    BaseRecalibrator                             Generates recalibration table for Base Quality Score Recalibration (BQSR)
    BaseRecalibratorSpark                        (BETA Tool) Generate recalibration table for Base Quality Score Recalibration (BQSR) on Spark
    BuildBamIndex (Picard)                       Generates a BAM index ".bai" file.  
    BwaAndMarkDuplicatesPipelineSpark            (BETA Tool) Takes name-sorted file and runs BWA and MarkDuplicates.
    BwaSpark                                     (BETA Tool) Align reads to a given reference using BWA on Spark
    CleanSam (Picard)                            Cleans a SAM/BAM/CRAM files, soft-clipping beyond-end-of-reference alignments and setting MAPQ to 0 for unmapped reads
    ClipReads                                    Clip reads in a SAM/BAM/CRAM file
    CollectDuplicateMetrics (Picard)             Collect Duplicate metrics from marked file.
    ConvertHeaderlessHadoopBamShardToBam         (BETA Tool) Convert a headerless BAM shard into a readable BAM
    DownsampleByDuplicateSet                     (BETA Tool) Discard a set fraction of duplicate sets from a UMI-grouped bam
    DownsampleSam (Picard)                       Downsample a SAM or BAM file.
    ExtractOriginalAlignmentRecordsByNameSpark   (BETA Tool) Subsets reads by name
    FastqToSam (Picard)                          Converts a FASTQ file to an unaligned BAM or SAM file
    FilterSamReads (Picard)                      Subsets reads from a SAM/BAM/CRAM file by applying one of several filters.
    FixMateInformation (Picard)                  Verify mate-pair information between mates and fix if needed.
    FixMisencodedBaseQualityReads                Fix Illumina base quality scores in a SAM/BAM/CRAM file
    GatherBamFiles (Picard)                      Concatenate efficiently BAM files that resulted from a scattered parallel analysis
    LeftAlignIndels                              Left-aligns indels from reads in a SAM/BAM/CRAM file
    MarkDuplicates (Picard)                      Identifies duplicate reads.  
    MarkDuplicatesSpark                          MarkDuplicates on Spark
    MarkDuplicatesWithMateCigar (Picard)         Identifies duplicate reads, accounting for mate CIGAR.  
    MergeBamAlignment (Picard)                   Merge alignment data from a SAM or BAM with data in an unmapped BAM file.  
    MergeSamFiles (Picard)                       Merges multiple SAM/BAM/CRAM (and/or) files into a single file.  
    PositionBasedDownsampleSam (Picard)          Downsample a SAM or BAM file to retain a subset of the reads based on the reads location in each tile in the flowcell.
    PostProcessReadsForRSEM                      (BETA Tool) Reorder reads before running RSEM
    PrintDistantMates                            Unmaps reads with distant mates.
    PrintReads                                   Print reads in the SAM/BAM/CRAM file
    PrintReadsHeader                             Print the header from a SAM/BAM/CRAM file
    PrintReadsSpark                              PrintReads on Spark
    ReorderSam (Picard)                          Reorders reads in a SAM or BAM file to match ordering in a second reference file.
    ReplaceSamHeader (Picard)                    Replaces the SAMFileHeader in a SAM/BAM/CRAM file.  
    RevertBaseQualityScores                      Revert Quality Scores in a SAM/BAM/CRAM file
    RevertOriginalBaseQualitiesAndAddMateCigar (Picard)Reverts the original base qualities and adds the mate cigar tag to read-group files
    RevertSam (Picard)                           Reverts SAM/BAM/CRAM files to a previous state.  
    RevertSamSpark                               (BETA Tool) Reverts SAM, BAM or CRAM files to a previous state.
    SamFormatConverter (Picard)                  Convert a BAM file to a SAM file, or a SAM to a BAM
    SamToFastq (Picard)                          Converts a SAM/BAM/CRAM file to FASTQ.
    SamToFastqWithTags (Picard)                  Converts a SAM or BAM file to FASTQ alongside FASTQs created from tags.
    SetNmAndUqTags (Picard)                      DEPRECATED: Use SetNmMdAndUqTags instead.
    SetNmMdAndUqTags (Picard)                    Fixes the NM, MD, and UQ tags in a SAM/BAM/CRAM file 
    SimpleMarkDuplicatesWithMateCigar (Picard)   (EXPERIMENTAL Tool) Examines aligned records in the supplied SAM or BAM file to locate duplicate molecules.
    SortSam (Picard)                             Sorts a SAM, BAM or CRAM file.  
    SortSamSpark                                 (BETA Tool) SortSam on Spark (works on SAM/BAM/CRAM)
    SplitNCigarReads                             Split Reads with N in Cigar
    SplitReads                                   Outputs reads from a SAM/BAM/CRAM by read group, sample and library name
    SplitSamByLibrary (Picard)                   Splits a SAM/BAM/CRAM file into individual files by library
    SplitSamByNumberOfReads (Picard)             Splits a SAM/BAM/CRAM file to multiple files.
    TransferReadTags                             (EXPERIMENTAL Tool) Incorporate read tags in a SAM file to that of a matching SAM file
    UmiAwareMarkDuplicatesWithMateCigar (Picard) (EXPERIMENTAL Tool) Identifies duplicate reads using information from read positions and UMIs. 
    UnmarkDuplicates                             Clears the 0x400 duplicate SAM flag

--------------------------------------------------------------------------------------
Reference:                                       Tools that analyze and manipulate FASTA format references
    BaitDesigner (Picard)                        Designs oligonucleotide baits for hybrid selection reactions.
    BwaMemIndexImageCreator                      Create a BWA-MEM index image file for use with GATK BWA tools
    CheckReferenceCompatibility                  (EXPERIMENTAL Tool) Check a BAM/VCF for compatibility against specified references.
    CompareReferences                            (EXPERIMENTAL Tool) Display reference comparison as a tab-delimited table and summarize reference differences.
    ComposeSTRTableFile                          Composes a genome-wide STR location table used for DragSTR model auto-calibration
    CountBasesInReference                        Count the numbers of each base in a reference file
    CreateSequenceDictionary (Picard)            Creates a sequence dictionary for a reference sequence.  
    ExtractSequences (Picard)                    Subsets intervals from a reference sequence to a new FASTA file.
    FastaAlternateReferenceMaker                 Create an alternative reference by combining a fasta with a vcf.
    FastaReferenceMaker                          Create snippets of a fasta file
    FindBadGenomicKmersSpark                     (BETA Tool) Identifies sequences that occur at high frequency in a reference
    NonNFastaSize (Picard)                       Counts the number of non-N bases in a fasta file.
    NormalizeFasta (Picard)                      Normalizes lines of sequence in a FASTA file to be of the same length.
    ScatterIntervalsByNs (Picard)                Writes an interval list created by splitting a reference at Ns.
    ShiftFasta                                   (BETA Tool) Creates a shifted fasta file and shift_back file

--------------------------------------------------------------------------------------
Short Variant Discovery:                         Tools that perform variant calling and genotyping for short variants (SNPs, SNVs and Indels)
    CalibrateDragstrModel                        estimates the parameters for the DRAGstr model
    CombineGVCFs                                 Merges one or more HaplotypeCaller GVCF files into a single GVCF with appropriate annotations
    GenomicsDBImport                             Import VCFs to GenomicsDB
    GenotypeGVCFs                                Perform joint genotyping on one or more samples pre-called with HaplotypeCaller
    GnarlyGenotyper                              (BETA Tool) Perform "quick and dirty" joint genotyping on one or more samples pre-called with HaplotypeCaller
    HaplotypeBasedVariantRecaller                (EXPERIMENTAL Tool) Calculate likelihood matrix for each Allele in VCF against a set of Reads limited by a set of Haplotypes
    HaplotypeCaller                              Call germline SNPs and indels via local re-assembly of haplotypes
    HaplotypeCallerSpark                         (BETA Tool) HaplotypeCaller on Spark
    LearnReadOrientationModel                    Get the maximum likelihood estimates of artifact prior probabilities in the orientation bias mixture model filter
    MergeMutectStats                             Merge the stats output by scatters of a single Mutect2 job
    Mutect2                                      Call somatic SNVs and indels via local assembly of haplotypes
    RampedHaplotypeCaller                        (EXPERIMENTAL Tool) Call germline SNPs and indels via local re-assembly of haplotypes (ramped version)
    ReadsPipelineSpark                           (BETA Tool) Runs BWA (if specified), MarkDuplicates, BQSR, and HaplotypeCaller on unaligned or aligned reads to generate a VCF.

--------------------------------------------------------------------------------------
Structural Variant Discovery:                    Tools that detect structural variants        
    CollectSVEvidence                            (BETA Tool) Gathers paired-end and split read evidence files for use in the GATK-SV pipeline.
    CondenseDepthEvidence                        (EXPERIMENTAL Tool) Merges adjacent DepthEvidence records.
    CpxVariantReInterpreterSpark                 (BETA Tool) (Internal) Tries to extract simple variants from a provided GATK-SV CPX.vcf
    DiscoverVariantsFromContigAlignmentsSAMSpark (BETA Tool) (Internal) Examines aligned contigs from local assemblies and calls structural variants
    ExtractSVEvidenceSpark                       (BETA Tool) (Internal) Extracts evidence of structural variations from reads
    FindBreakpointEvidenceSpark                  (BETA Tool) (Internal) Produces local assemblies of genomic regions that may harbor structural variants
    JointGermlineCNVSegmentation                 (BETA Tool) Combine segmented gCNV VCFs.
    PrintReadCounts                              (EXPERIMENTAL Tool) Prints count files for CNV determination.
    PrintSVEvidence                              (EXPERIMENTAL Tool) Merges SV evidence records.
    SVAnnotate                                   Adds gene overlap and variant consequence annotations to SV VCF from GATK-SV pipeline
    SVCluster                                    (BETA Tool) Clusters structural variants
    SiteDepthtoBAF                               (EXPERIMENTAL Tool) Convert SiteDepth to BafEvidence
    StructuralVariantDiscoverer                  (BETA Tool) (Internal) Examines aligned contigs from local assemblies and calls structural variants or their breakpoints
    StructuralVariationDiscoveryPipelineSpark    (BETA Tool) Runs the structural variation discovery workflow on a single sample
    SvDiscoverFromLocalAssemblyContigAlignmentsSpark    (BETA Tool) (Internal) Examines aligned contigs from local assemblies and calls structural variants or their breakpoints

--------------------------------------------------------------------------------------
Variant Evaluation and Refinement:               Tools that evaluate and refine variant calls, e.g. with annotations not offered by the engine
    AlleleFrequencyQC                            (BETA Tool) General-purpose tool for variant evaluation (% in dbSNP, genotype concordance, Ti/Tv ratios, and a lot more)
    AnnotateVcfWithBamDepth                      (Internal) Annotate a vcf with a bam's read depth at each variant locus
    AnnotateVcfWithExpectedAlleleFraction        (Internal) Annotate a vcf with expected allele fractions in pooled sequencing
    CalculateGenotypePosteriors                  Calculate genotype posterior probabilities given family and/or known population genotypes
    CalculateMixingFractions                     (Internal) Calculate proportions of different samples in a pooled bam
    Concordance                                  Evaluate concordance of an input VCF against a validated truth VCF
    CountFalsePositives                          (BETA Tool) Count PASS variants
    CountVariants                                Counts variant records in a VCF file, regardless of filter status.
    CountVariantsSpark                           CountVariants on Spark
    EvaluateInfoFieldConcordance                 (BETA Tool) Evaluate concordance of info fields in an input VCF against a validated truth VCF
    FilterFuncotations                           (EXPERIMENTAL Tool) Filter variants based on clinically-significant Funcotations.
    FindMendelianViolations (Picard)             Finds mendelian violations of all types within a VCF
    FuncotateSegments                            (BETA Tool) Functional annotation for segment files.  The output formats are not well-defined and subject to change.
    Funcotator                                   Functional Annotator
    FuncotatorDataSourceDownloader               Data source downloader for Funcotator.
    GenotypeConcordance (Picard)                 Calculates the concordance between genotype data of one sample in each of two VCFs - truth (or reference) vs. calls.
    MergeMutect2CallsWithMC3                     (EXPERIMENTAL Tool) UNSUPPORTED.  FOR EVALUATION ONLY. Merge M2 calls with MC
    ReferenceBlockConcordance                    Evaluate GVCF reference block concordance of an input GVCF against a truth GVCF
    ValidateBasicSomaticShortMutations           (EXPERIMENTAL Tool) Check variants against tumor-normal bams representing the same samples, though not the ones from the actual calls.
    ValidateVariants                             Validate VCF
    VariantEval                                  (BETA Tool) General-purpose tool for variant evaluation (% in dbSNP, genotype concordance, Ti/Tv ratios, and a lot more)
    VariantsToTable                              Extract fields from a VCF file to a tab-delimited table

--------------------------------------------------------------------------------------
Variant Filtering:                               Tools that filter variants by annotating the FILTER column
    ApplyVQSR                                     Apply a score cutoff to filter variants based on a recalibration table
    CNNScoreVariants                             Apply a Convolutional Neural Net to filter annotated variants
    CNNVariantTrain                              (EXPERIMENTAL Tool) Train a CNN model for filtering variants
    CNNVariantWriteTensors                       (EXPERIMENTAL Tool) Write variant tensors for training a CNN to filter variants
    CreateSomaticPanelOfNormals                  (BETA Tool) Make a panel of normals for use with Mutect2
    ExtractVariantAnnotations                    (BETA Tool) Extracts site-level variant annotations, labels, and other metadata from a VCF file to HDF5 files
    FilterAlignmentArtifacts                     (EXPERIMENTAL Tool) Filter alignment artifacts from a vcf callset.
    FilterMutectCalls                            Filter somatic SNVs and indels called by Mutect2
    FilterVariantTranches                        Apply tranche filtering
    FilterVcf (Picard)                           Hard filters a VCF.
    MTLowHeteroplasmyFilterTool                  If too many low het sites, filter all low het sites
    NuMTFilterTool                               Uses the median autosomal coverage and the allele depth to determine whether the allele might be a NuMT
    ScoreVariantAnnotations                      (BETA Tool) Scores variant calls in a VCF file based on site-level annotations using a previously trained model
    TrainVariantAnnotationsModel                 (BETA Tool) Trains a model for scoring variant calls based on site-level annotations
    VariantFiltration                            Filter variant calls based on INFO and/or FORMAT annotations
    VariantRecalibrator                          Build a recalibration model to score variant quality for filtering purposes

--------------------------------------------------------------------------------------
Variant Manipulation:                            Tools that manipulate variant call format (VCF) data
    FixVcfHeader (Picard)                        Replaces or fixes a VCF header.
    GatherVcfs (Picard)                          Gathers multiple VCF files from a scatter operation into a single VCF file
    GatherVcfsCloud                              (BETA Tool) Gathers multiple VCF files from a scatter operation into a single VCF file
    LeftAlignAndTrimVariants                     Left align and trim vairants
    LiftoverVcf (Picard)                         Lifts over a VCF file from one reference build to another.  
    MakeSitesOnlyVcf (Picard)                    Creates a VCF that contains all the site-level information for all records in the input VCF but no genotype information.
    MakeVcfSampleNameMap (Picard)                Creates a TSV from sample name to VCF/GVCF path, with one line per input.
    MergeVcfs (Picard)                           Combines multiple variant files into a single variant file
    PrintVariantsSpark                           Prints out variants from the input VCF.
    RemoveNearbyIndels                           (Internal) Remove indels from the VCF file that are close to each other.
    RenameSampleInVcf (Picard)                   Renames a sample within a VCF or BCF.
    SelectVariants                               Select a subset of variants from a VCF file
    SortVcf (Picard)                             Sorts one or more VCF files.  
    SplitVcfs (Picard)                           Splits SNPs and INDELs into separate files.  
    UpdateVCFSequenceDictionary                  Updates the sequence dictionary in a variant file.
    UpdateVcfSequenceDictionary (Picard)         Takes a VCF and a second file that contains a sequence dictionary and updates the VCF with the new sequence dictionary.
    VariantAnnotator                             Tool for adding annotations to VCF files
    VcfFormatConverter (Picard)                  Converts VCF to BCF or BCF to VCF.  
    VcfToIntervalList (Picard)                   Converts a VCF or BCF file to a Picard Interval List

--------------------------------------------------------------------------------------

***********************************************************************

A USER ERROR has occurred: '-Xmx104857M' is not a valid command.


***********************************************************************
Set the system property GATK_STACKTRACE_ON_USER_EXCEPTION (--java-options '-DGATK_STACKTRACE_ON_USER_EXCEPTION=true') to print the stack trace.
Using GATK jar /gatk/gatk-package-4.3.0.0-local.jar
Running:
    java -Dsamjdk.use_async_io_read_samtools=false -Dsamjdk.use_async_io_write_samtools=true -Dsamjdk.use_async_io_write_tribble=false -Dsamjdk.compression_level=2 -jar /gatk/gatk-package-4.3.0.0-local.jar -Xmx104857M SplitNCigarReads -R input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta -I output.temp/Le1-12-501-708_1.fastq.gz_addrg_repN.bam -O output2/Le1-12-501-708_1.fastq.gz.bam
/usr/local/bin/picard: line 5: warning: setlocale: LC_ALL: cannot change locale (en_US.UTF-8): No such file or directory
INFO	2023-02-28 23:40:41	AddOrReplaceReadGroups	

********** NOTE: Picard's command line syntax is changing.
**********
********** For more information, please see:
********** https://github.com/broadinstitute/picard/wiki/Command-Line-Syntax-Transition-For-Users-(Pre-Transition)
**********
********** The command line looks like this in the new syntax:
**********
**********    AddOrReplaceReadGroups -I output/Le1-13-502-701_1.fastq.gz.bam -O output.temp/Le1-13-502-701_1.fastq.gz_addrg.bam -SO coordinate -RGID Le1-13-502-701_1.fastq.gz -RGLB library -RGPL Illumina -RGPU Illumina -RGSM Le1-13-502-701_1.fastq.gz
**********


23:40:41.719 INFO  NativeLibraryLoader - Loading libgkl_compression.so from jar:file:/usr/local/share/picard-2.18.27-0/picard.jar!/com/intel/gkl/native/libgkl_compression.so
[Tue Feb 28 23:40:41 GMT 2023] AddOrReplaceReadGroups INPUT=output/Le1-13-502-701_1.fastq.gz.bam OUTPUT=output.temp/Le1-13-502-701_1.fastq.gz_addrg.bam SORT_ORDER=coordinate RGID=Le1-13-502-701_1.fastq.gz RGLB=library RGPL=Illumina RGPU=Illumina RGSM=Le1-13-502-701_1.fastq.gz    VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false GA4GH_CLIENT_SECRETS=client_secrets.json USE_JDK_DEFLATER=false USE_JDK_INFLATER=false
[Tue Feb 28 23:40:41 GMT 2023] Executing as ?@9dff24c3b9b6 on Linux 3.10.0-1160.36.2.el7.x86_64 amd64; OpenJDK 64-Bit Server VM 11.0.1+13-LTS; Deflater: Intel; Inflater: Intel; Provider GCS is not available; Picard version: 2.18.27-SNAPSHOT
INFO	2023-02-28 23:40:41	AddOrReplaceReadGroups	Created read-group ID=Le1-13-502-701_1.fastq.gz PL=Illumina LB=library SM=Le1-13-502-701_1.fastq.gz

[Tue Feb 28 23:40:47 GMT 2023] picard.sam.AddOrReplaceReadGroups done. Elapsed time: 0.09 minutes.
Runtime.totalMemory()=2600468480
USAGE:   [-h]

Available Programs:
--------------------------------------------------------------------------------------
Base Calling:                                    Tools that process sequencing machine data, e.g. Illumina base calls, and detect sequencing level attributes, e.g. adapters
    CheckIlluminaDirectory (Picard)              Asserts the validity for specified Illumina basecalling data.  
    CollectIlluminaBasecallingMetrics (Picard)   Collects Illumina Basecalling metrics for a sequencing run.  
    CollectIlluminaLaneMetrics (Picard)          Collects Illumina lane metrics for the given BaseCalling analysis directory.
    ExtractIlluminaBarcodes (Picard)             Tool determines the barcode for each read in an Illumina lane.  
    IlluminaBasecallsToFastq (Picard)            Generate FASTQ file(s) from Illumina basecall read data.  
    IlluminaBasecallsToSam (Picard)              Transforms raw Illumina sequencing data into an unmapped SAM, BAM or CRAM file.
    MarkIlluminaAdapters (Picard)                Reads a SAM/BAM/CRAM file and rewrites it with new adapter-trimming tags.  

--------------------------------------------------------------------------------------
Copy Number Variant Discovery:                   Tools that analyze read coverage to detect copy number variants.
    AnnotateIntervals                            Annotates intervals with GC content, mappability, and segmental-duplication content
    CallCopyRatioSegments                        Calls copy-ratio segments as amplified, deleted, or copy-number neutral
    CombineSegmentBreakpoints                    (EXPERIMENTAL Tool) Combine the breakpoints of two segment files and annotate the resulting intervals with chosen columns from each file.
    CreateReadCountPanelOfNormals                Creates a panel of normals for read-count denoising
    DenoiseReadCounts                            Denoises read counts to produce denoised copy ratios
    DetermineGermlineContigPloidy                Determines the baseline contig ploidy for germline samples given counts data
    FilterIntervals                              Filters intervals based on annotations and/or count statistics
    GermlineCNVCaller                            Calls copy-number variants in germline samples given their counts and the output of DetermineGermlineContigPloidy
    MergeAnnotatedRegions                        (EXPERIMENTAL Tool) Merge annotated genomic regions based entirely on touching/overlapping intervals.
    MergeAnnotatedRegionsByAnnotation            (EXPERIMENTAL Tool) Merge annotated genomic regions within specified distance if annotation value(s) are exactly the same.
    ModelSegments                                Models segmented copy ratios from denoised copy ratios and segmented minor-allele fractions from allelic counts
    PlotDenoisedCopyRatios                       Creates plots of denoised copy ratios
    PlotModeledSegments                          Creates plots of denoised and segmented copy-ratio and minor-allele-fraction estimates
    PostprocessGermlineCNVCalls                  Postprocesses the output of GermlineCNVCaller and generates VCFs and denoised copy ratios
    TagGermlineEvents                            (EXPERIMENTAL Tool) Do a simplistic tagging of germline events in a tumor segment file.

--------------------------------------------------------------------------------------
Coverage Analysis:                               Tools that count coverage, e.g. depth per allele
    ASEReadCounter                               Generates table of filtered base counts at het sites for allele specific expression
    AnalyzeSaturationMutagenesis                 (BETA Tool) (EXPERIMENTAL) Processes reads from a MITESeq or other saturation mutagenesis experiment.
    CollectAllelicCounts                         Collects reference and alternate allele counts at specified sites
    CollectAllelicCountsSpark                    Collects reference and alternate allele counts at specified sites
    CollectF1R2Counts                            Collect F1R2 read counts for the Mutect2 orientation bias mixture model filter
    CollectReadCounts                            Collects read counts at specified intervals
    CountBases                                   Count bases in a SAM/BAM/CRAM file
    CountBasesSpark                              Counts bases in the input SAM/BAM
    CountReads                                   Count reads in a SAM/BAM/CRAM file
    CountReadsSpark                              Counts reads in the input SAM/BAM
    DepthOfCoverage                              (BETA Tool) Generate coverage summary information for reads data
    GatherNormalArtifactData                     Combine output files from GetNormalArtifactData in the order defined by a sequence dictionary
    GeneExpressionEvaluation                     (BETA Tool) Evaluate gene expression from RNA-seq reads aligned to genome.
    GetNormalArtifactData                        Collects data for training normal artifact filter
    GetPileupSummaries                           Tabulates pileup metrics for inferring contamination
    LocalAssembler                               (BETA Tool) Local assembler for SVs
    Pileup                                       Prints read alignments in samtools pileup format
    PileupSpark                                  (BETA Tool) Prints read alignments in samtools pileup format

--------------------------------------------------------------------------------------
Diagnostics and Quality Control:                 Tools that collect sequencing quality related and comparative metrics
    AccumulateQualityYieldMetrics (Picard)       Combines multiple QualityYieldMetrics files into a single file.
    AccumulateVariantCallingMetrics (Picard)     Combines multiple Variant Calling Metrics files into a single file
    AnalyzeCovariates                            Evaluate and compare base quality score recalibration (BQSR) tables
    BamIndexStats (Picard)                       Generate index statistics from a BAM file
    CalcMetadataSpark                            (BETA Tool) (Internal) Collects read metrics relevant to structural variant discovery
    CalculateContamination                       Calculate the fraction of reads coming from cross-sample contamination
    CalculateFingerprintMetrics (Picard)         Calculate statistics on fingerprints, checking their viability
    CalculateReadGroupChecksum (Picard)          Creates a hash code based on the read groups (RG).  
    CheckDuplicateMarking (Picard)               Checks the consistency of duplicate markings.
    CheckFingerprint (Picard)                    Computes a fingerprint from the supplied input (SAM/BAM/CRAM or VCF) file and compares it to the provided genotypes
    CheckPileup                                  Compare GATK's internal pileup to a reference Samtools mpileup
    CheckTerminatorBlock (Picard)                Asserts the provided gzip file's (e.g., BAM) last block is well-formed; RC 100 otherwise
    ClusterCrosscheckMetrics (Picard)            Clusters the results of a CrosscheckFingerprints run by LOD score
    CollectAlignmentSummaryMetrics (Picard)      Produces a summary of alignment metrics from a SAM or BAM file.  
    CollectArraysVariantCallingMetrics (Picard)  Collects summary and per-sample from the provided arrays VCF file
    CollectBaseDistributionByCycle (Picard)      Chart the nucleotide distribution per cycle in a SAM or BAM file
    CollectBaseDistributionByCycleSpark          (BETA Tool) Collects base distribution per cycle in SAM/BAM/CRAM file(s).
    CollectGcBiasMetrics (Picard)                Collect metrics regarding GC bias. 
    CollectHiSeqXPfFailMetrics (Picard)          Classify PF-Failing reads in a HiSeqX Illumina Basecalling directory into various categories.
    CollectHsMetrics (Picard)                    Collects hybrid-selection (HS) metrics for a SAM or BAM file.  
    CollectIndependentReplicateMetrics (Picard)  (EXPERIMENTAL Tool) Estimates the rate of independent replication rate of reads within a bam. 

    CollectInsertSizeMetrics (Picard)            Collect metrics about the insert size distribution of a paired-end library. 
    CollectInsertSizeMetricsSpark                (BETA Tool) Collects insert size distribution information on alignment data
    CollectJumpingLibraryMetrics (Picard)        Collect jumping library metrics. 
    CollectMultipleMetrics (Picard)              Collect multiple classes of metrics. 
    CollectMultipleMetricsSpark                  (BETA Tool) Runs multiple metrics collection modules for a given alignment file
    CollectOxoGMetrics (Picard)                  Collect metrics to assess oxidative artifacts.
    CollectQualityYieldMetrics (Picard)          Collect metrics about reads that pass quality thresholds and Illumina-specific filters.  
    CollectQualityYieldMetricsSpark              (BETA Tool) Collects quality yield metrics from SAM/BAM/CRAM file(s).
    CollectRawWgsMetrics (Picard)                Collect whole genome sequencing-related metrics.  
    CollectRnaSeqMetrics (Picard)                Produces RNA alignment metrics for a SAM or BAM file.  
    CollectRrbsMetrics (Picard)                  Collects metrics from reduced representation bisulfite sequencing (Rrbs) data.  
    CollectSamErrorMetrics (Picard)              Program to collect error metrics on bases stratified in various ways.
    CollectSequencingArtifactMetrics (Picard)    Collect metrics to quantify single-base sequencing artifacts.  
    CollectTargetedPcrMetrics (Picard)           Calculate PCR-related metrics from targeted sequencing data. 
    CollectVariantCallingMetrics (Picard)        Collects per-sample and aggregate (spanning all samples) metrics from the provided VCF file
    CollectWgsMetrics (Picard)                   Collect metrics about coverage and performance of whole genome sequencing (WGS) experiments.
    CollectWgsMetricsWithNonZeroCoverage (Picard)(EXPERIMENTAL Tool) Collect metrics about coverage and performance of whole genome sequencing (WGS) experiments.  
    CompareBaseQualities                         Compares the base qualities of two SAM/BAM/CRAM files
    CompareDuplicatesSpark                       (BETA Tool) Determine if two potentially identical BAMs have the same duplicate reads
    CompareMetrics (Picard)                      Compare two metrics files.
    CompareSAMs (Picard)                         Compare two input SAM/BAM/CRAM files.  
    ConvertHaplotypeDatabaseToVcf (Picard)       Convert Haplotype database file to vcf
    ConvertSequencingArtifactToOxoG (Picard)     Extract OxoG metrics from generalized artifacts metrics.  
    CrosscheckFingerprints (Picard)              Checks that all data in the input files appear to have come from the same individual
    CrosscheckReadGroupFingerprints (Picard)     DEPRECATED: USE CrosscheckFingerprints. 
    DumpTabixIndex                               Dumps a tabix index file.
    EstimateLibraryComplexity (Picard)           Estimates the numbers of unique molecules in a sequencing library.  
    ExtractFingerprint (Picard)                  Computes a fingerprint from the input file.
    FlagStat                                     Accumulate flag statistics given a BAM file
    FlagStatSpark                                Spark tool to accumulate flag statistics
    GatherPileupSummaries                        Combine output files from GetPileupSummary in the order defined by a sequence dictionary
    GetSampleName                                Emit a single sample name
    IdentifyContaminant (Picard)                 Computes a fingerprint from the supplied SAM/BAM file, given a contamination estimate.
    LiftOverHaplotypeMap (Picard)                Lifts over a haplotype database from one reference to another
    MeanQualityByCycle (Picard)                  Collect mean quality by cycle.
    MeanQualityByCycleSpark                      (BETA Tool) MeanQualityByCycle on Spark
    QualityScoreDistribution (Picard)            Chart the distribution of quality scores.  
    QualityScoreDistributionSpark                (BETA Tool) QualityScoreDistribution on Spark
    ValidateSamFile (Picard)                     Validates a SAM/BAM/CRAM file.
    ViewSam (Picard)                             Prints a SAM or BAM file to the screen

--------------------------------------------------------------------------------------
Example Tools:                                   Example tools that show developers how to implement new tools
    ExampleMultiFeatureWalker                    Example of a MultiFeatureWalker subclass.
    HtsgetReader                                 (EXPERIMENTAL Tool) Download a file using htsget

--------------------------------------------------------------------------------------
Flow Based Tools:                                Tools designed specifically to operate on flow based data
    CalculateAverageCombinedAnnotations          (EXPERIMENTAL Tool) Divides annotations that were summed by genomicsDB by number of samples to calculate average.
    FlowFeatureMapper                            (EXPERIMENTAL Tool) Map/find features in BAM file, output VCF. Initially mapping SNVs
    GroundTruthReadsBuilder                      (EXPERIMENTAL Tool) Produces a flexible and robust ground truth set for base calling training
    SplitCRAM                                    (EXPERIMENTAL Tool) Split CRAM files to smaller files efficiently

--------------------------------------------------------------------------------------
Genotyping Arrays Manipulation:                  Tools that manipulate data generated by Genotyping arrays
    BpmToNormalizationManifestCsv (Picard)       Program to convert an Illumina bpm file into a bpm.csv file.
    CombineGenotypingArrayVcfs (Picard)          Program to combine multiple genotyping array VCF files into one VCF.
    CompareGtcFiles (Picard)                     Compares two GTC files.
    CreateBafRegressMetricsFile (Picard)         Program to generate a picard metrics file from the output of the bafRegress tool.
    CreateExtendedIlluminaManifest (Picard)      Create an Extended Illumina Manifest for usage by the Picard tool GtcToVcf
    CreateVerifyIDIntensityContaminationMetricsFile (Picard)    Program to generate a picard metrics file from the output of the VerifyIDIntensity tool.
    GtcToVcf (Picard)                            Program to convert an Illumina GTC file to a VCF
    MergePedIntoVcf (Picard)                     Program to merge a single-sample ped file from zCall into a single-sample VCF.
    VcfToAdpc (Picard)                           Program to convert an Arrays VCF to an ADPC file.

--------------------------------------------------------------------------------------
Intervals Manipulation:                          Tools that process genomic intervals in various formats
    BedToIntervalList (Picard)                   Converts a BED file to a Picard Interval List.  
    CompareIntervalLists                         Compare two interval lists for equality
    IntervalListToBed (Picard)                   Converts an Picard IntervalList file to a BED file.
    IntervalListTools (Picard)                   A tool for performing various IntervalList manipulations
    LiftOverIntervalList (Picard)                Lifts over an interval list from one reference build to another. 
    PreprocessIntervals                          Prepares bins for coverage collection
    SplitIntervals                               Split intervals into sub-interval files.

--------------------------------------------------------------------------------------
Metagenomics:                                    Tools that perform metagenomic analysis, e.g. microbial community composition and pathogen detection
    PathSeqBuildKmers                            Builds set of host reference k-mers
    PathSeqBuildReferenceTaxonomy                Builds a taxonomy datafile of the microbe reference
    PathSeqBwaSpark                              Step 2: Aligns reads to the microbe reference
    PathSeqFilterSpark                           Step 1: Filters low quality, low complexity, duplicate, and host reads
    PathSeqPipelineSpark                         Combined tool that performs all steps: read filtering, microbe reference alignment, and abundance scoring
    PathSeqScoreSpark                            Step 3: Classifies pathogen-aligned reads and generates abundance scores

--------------------------------------------------------------------------------------
Methylation-Specific Tools:                      Tools that perform methylation calling, processing bisulfite sequenced, methylation-aware aligned BAM
    MethylationTypeCaller                        (EXPERIMENTAL Tool) Identify methylated bases from bisulfite sequenced, methylation-aware BAMs

--------------------------------------------------------------------------------------
Other:                                           Miscellaneous tools, e.g. those that aid in data streaming
    CreateHadoopBamSplittingIndex                (BETA Tool) Create a Hadoop BAM splitting index
    FifoBuffer (Picard)                          Provides a large, FIFO buffer that can be used to buffer input and output streams between programs.
    GatherBQSRReports                            Gathers scattered BQSR recalibration reports into a single file
    GatherTranches                               (BETA Tool) Gathers scattered VQSLOD tranches into a single file
    IndexFeatureFile                             Creates an index for a feature file, e.g. VCF or BED file.
    ParallelCopyGCSDirectoryIntoHDFSSpark        (BETA Tool) Parallel copy a file or directory from Google Cloud Storage into the HDFS file system used by Spark
    PrintBGZFBlockInformation                    (EXPERIMENTAL Tool) Print information about the compressed blocks in a BGZF format file
    ReadAnonymizer                               (EXPERIMENTAL Tool) Replace bases in reads with reference bases.
    ReblockGVCF                                  Condenses homRef blocks in a single-sample GVCF
    SortGff (Picard)                             Sorts a gff3 file, and adds flush directives

--------------------------------------------------------------------------------------
Read Data Manipulation:                          Tools that manipulate read data in SAM, BAM or CRAM format
    AddCommentsToBam (Picard)                    Adds comments to the header of a BAM file.
    AddOATag (Picard)                            Record current alignment information to OA tag.
    AddOrReplaceReadGroups (Picard)              Assigns all the reads in a file to a single new read-group.
    AddOriginalAlignmentTags                     (EXPERIMENTAL Tool) Adds Original Alignment tag and original mate contig tag
    ApplyBQSR                                    Apply base quality score recalibration
    ApplyBQSRSpark                               (BETA Tool) Apply base quality score recalibration on Spark
    BQSRPipelineSpark                            (BETA Tool) Both steps of BQSR (BaseRecalibrator and ApplyBQSR) on Spark
    BamToBfq (Picard)                            Converts a BAM file into a BFQ (binary fastq formatted) file
    BaseRecalibrator                             Generates recalibration table for Base Quality Score Recalibration (BQSR)
    BaseRecalibratorSpark                        (BETA Tool) Generate recalibration table for Base Quality Score Recalibration (BQSR) on Spark
    BuildBamIndex (Picard)                       Generates a BAM index ".bai" file.  
    BwaAndMarkDuplicatesPipelineSpark            (BETA Tool) Takes name-sorted file and runs BWA and MarkDuplicates.
    BwaSpark                                     (BETA Tool) Align reads to a given reference using BWA on Spark
    CleanSam (Picard)                            Cleans a SAM/BAM/CRAM files, soft-clipping beyond-end-of-reference alignments and setting MAPQ to 0 for unmapped reads
    ClipReads                                    Clip reads in a SAM/BAM/CRAM file
    CollectDuplicateMetrics (Picard)             Collect Duplicate metrics from marked file.
    ConvertHeaderlessHadoopBamShardToBam         (BETA Tool) Convert a headerless BAM shard into a readable BAM
    DownsampleByDuplicateSet                     (BETA Tool) Discard a set fraction of duplicate sets from a UMI-grouped bam
    DownsampleSam (Picard)                       Downsample a SAM or BAM file.
    ExtractOriginalAlignmentRecordsByNameSpark   (BETA Tool) Subsets reads by name
    FastqToSam (Picard)                          Converts a FASTQ file to an unaligned BAM or SAM file
    FilterSamReads (Picard)                      Subsets reads from a SAM/BAM/CRAM file by applying one of several filters.
    FixMateInformation (Picard)                  Verify mate-pair information between mates and fix if needed.
    FixMisencodedBaseQualityReads                Fix Illumina base quality scores in a SAM/BAM/CRAM file
    GatherBamFiles (Picard)                      Concatenate efficiently BAM files that resulted from a scattered parallel analysis
    LeftAlignIndels                              Left-aligns indels from reads in a SAM/BAM/CRAM file
    MarkDuplicates (Picard)                      Identifies duplicate reads.  
    MarkDuplicatesSpark                          MarkDuplicates on Spark
    MarkDuplicatesWithMateCigar (Picard)         Identifies duplicate reads, accounting for mate CIGAR.  
    MergeBamAlignment (Picard)                   Merge alignment data from a SAM or BAM with data in an unmapped BAM file.  
    MergeSamFiles (Picard)                       Merges multiple SAM/BAM/CRAM (and/or) files into a single file.  
    PositionBasedDownsampleSam (Picard)          Downsample a SAM or BAM file to retain a subset of the reads based on the reads location in each tile in the flowcell.
    PostProcessReadsForRSEM                      (BETA Tool) Reorder reads before running RSEM
    PrintDistantMates                            Unmaps reads with distant mates.
    PrintReads                                   Print reads in the SAM/BAM/CRAM file
    PrintReadsHeader                             Print the header from a SAM/BAM/CRAM file
    PrintReadsSpark                              PrintReads on Spark
    ReorderSam (Picard)                          Reorders reads in a SAM or BAM file to match ordering in a second reference file.
    ReplaceSamHeader (Picard)                    Replaces the SAMFileHeader in a SAM/BAM/CRAM file.  
    RevertBaseQualityScores                      Revert Quality Scores in a SAM/BAM/CRAM file
    RevertOriginalBaseQualitiesAndAddMateCigar (Picard)Reverts the original base qualities and adds the mate cigar tag to read-group files
    RevertSam (Picard)                           Reverts SAM/BAM/CRAM files to a previous state.  
    RevertSamSpark                               (BETA Tool) Reverts SAM, BAM or CRAM files to a previous state.
    SamFormatConverter (Picard)                  Convert a BAM file to a SAM file, or a SAM to a BAM
    SamToFastq (Picard)                          Converts a SAM/BAM/CRAM file to FASTQ.
    SamToFastqWithTags (Picard)                  Converts a SAM or BAM file to FASTQ alongside FASTQs created from tags.
    SetNmAndUqTags (Picard)                      DEPRECATED: Use SetNmMdAndUqTags instead.
    SetNmMdAndUqTags (Picard)                    Fixes the NM, MD, and UQ tags in a SAM/BAM/CRAM file 
    SimpleMarkDuplicatesWithMateCigar (Picard)   (EXPERIMENTAL Tool) Examines aligned records in the supplied SAM or BAM file to locate duplicate molecules.
    SortSam (Picard)                             Sorts a SAM, BAM or CRAM file.  
    SortSamSpark                                 (BETA Tool) SortSam on Spark (works on SAM/BAM/CRAM)
    SplitNCigarReads                             Split Reads with N in Cigar
    SplitReads                                   Outputs reads from a SAM/BAM/CRAM by read group, sample and library name
    SplitSamByLibrary (Picard)                   Splits a SAM/BAM/CRAM file into individual files by library
    SplitSamByNumberOfReads (Picard)             Splits a SAM/BAM/CRAM file to multiple files.
    TransferReadTags                             (EXPERIMENTAL Tool) Incorporate read tags in a SAM file to that of a matching SAM file
    UmiAwareMarkDuplicatesWithMateCigar (Picard) (EXPERIMENTAL Tool) Identifies duplicate reads using information from read positions and UMIs. 
    UnmarkDuplicates                             Clears the 0x400 duplicate SAM flag

--------------------------------------------------------------------------------------
Reference:                                       Tools that analyze and manipulate FASTA format references
    BaitDesigner (Picard)                        Designs oligonucleotide baits for hybrid selection reactions.
    BwaMemIndexImageCreator                      Create a BWA-MEM index image file for use with GATK BWA tools
    CheckReferenceCompatibility                  (EXPERIMENTAL Tool) Check a BAM/VCF for compatibility against specified references.
    CompareReferences                            (EXPERIMENTAL Tool) Display reference comparison as a tab-delimited table and summarize reference differences.
    ComposeSTRTableFile                          Composes a genome-wide STR location table used for DragSTR model auto-calibration
    CountBasesInReference                        Count the numbers of each base in a reference file
    CreateSequenceDictionary (Picard)            Creates a sequence dictionary for a reference sequence.  
    ExtractSequences (Picard)                    Subsets intervals from a reference sequence to a new FASTA file.
    FastaAlternateReferenceMaker                 Create an alternative reference by combining a fasta with a vcf.
    FastaReferenceMaker                          Create snippets of a fasta file
    FindBadGenomicKmersSpark                     (BETA Tool) Identifies sequences that occur at high frequency in a reference
    NonNFastaSize (Picard)                       Counts the number of non-N bases in a fasta file.
    NormalizeFasta (Picard)                      Normalizes lines of sequence in a FASTA file to be of the same length.
    ScatterIntervalsByNs (Picard)                Writes an interval list created by splitting a reference at Ns.
    ShiftFasta                                   (BETA Tool) Creates a shifted fasta file and shift_back file

--------------------------------------------------------------------------------------
Short Variant Discovery:                         Tools that perform variant calling and genotyping for short variants (SNPs, SNVs and Indels)
    CalibrateDragstrModel                        estimates the parameters for the DRAGstr model
    CombineGVCFs                                 Merges one or more HaplotypeCaller GVCF files into a single GVCF with appropriate annotations
    GenomicsDBImport                             Import VCFs to GenomicsDB
    GenotypeGVCFs                                Perform joint genotyping on one or more samples pre-called with HaplotypeCaller
    GnarlyGenotyper                              (BETA Tool) Perform "quick and dirty" joint genotyping on one or more samples pre-called with HaplotypeCaller
    HaplotypeBasedVariantRecaller                (EXPERIMENTAL Tool) Calculate likelihood matrix for each Allele in VCF against a set of Reads limited by a set of Haplotypes
    HaplotypeCaller                              Call germline SNPs and indels via local re-assembly of haplotypes
    HaplotypeCallerSpark                         (BETA Tool) HaplotypeCaller on Spark
    LearnReadOrientationModel                    Get the maximum likelihood estimates of artifact prior probabilities in the orientation bias mixture model filter
    MergeMutectStats                             Merge the stats output by scatters of a single Mutect2 job
    Mutect2                                      Call somatic SNVs and indels via local assembly of haplotypes
    RampedHaplotypeCaller                        (EXPERIMENTAL Tool) Call germline SNPs and indels via local re-assembly of haplotypes (ramped version)
    ReadsPipelineSpark                           (BETA Tool) Runs BWA (if specified), MarkDuplicates, BQSR, and HaplotypeCaller on unaligned or aligned reads to generate a VCF.

--------------------------------------------------------------------------------------
Structural Variant Discovery:                    Tools that detect structural variants        
    CollectSVEvidence                            (BETA Tool) Gathers paired-end and split read evidence files for use in the GATK-SV pipeline.
    CondenseDepthEvidence                        (EXPERIMENTAL Tool) Merges adjacent DepthEvidence records.
    CpxVariantReInterpreterSpark                 (BETA Tool) (Internal) Tries to extract simple variants from a provided GATK-SV CPX.vcf
    DiscoverVariantsFromContigAlignmentsSAMSpark (BETA Tool) (Internal) Examines aligned contigs from local assemblies and calls structural variants
    ExtractSVEvidenceSpark                       (BETA Tool) (Internal) Extracts evidence of structural variations from reads
    FindBreakpointEvidenceSpark                  (BETA Tool) (Internal) Produces local assemblies of genomic regions that may harbor structural variants
    JointGermlineCNVSegmentation                 (BETA Tool) Combine segmented gCNV VCFs.
    PrintReadCounts                              (EXPERIMENTAL Tool) Prints count files for CNV determination.
    PrintSVEvidence                              (EXPERIMENTAL Tool) Merges SV evidence records.
    SVAnnotate                                   Adds gene overlap and variant consequence annotations to SV VCF from GATK-SV pipeline
    SVCluster                                    (BETA Tool) Clusters structural variants
    SiteDepthtoBAF                               (EXPERIMENTAL Tool) Convert SiteDepth to BafEvidence
    StructuralVariantDiscoverer                  (BETA Tool) (Internal) Examines aligned contigs from local assemblies and calls structural variants or their breakpoints
    StructuralVariationDiscoveryPipelineSpark    (BETA Tool) Runs the structural variation discovery workflow on a single sample
    SvDiscoverFromLocalAssemblyContigAlignmentsSpark    (BETA Tool) (Internal) Examines aligned contigs from local assemblies and calls structural variants or their breakpoints

--------------------------------------------------------------------------------------
Variant Evaluation and Refinement:               Tools that evaluate and refine variant calls, e.g. with annotations not offered by the engine
    AlleleFrequencyQC                            (BETA Tool) General-purpose tool for variant evaluation (% in dbSNP, genotype concordance, Ti/Tv ratios, and a lot more)
    AnnotateVcfWithBamDepth                      (Internal) Annotate a vcf with a bam's read depth at each variant locus
    AnnotateVcfWithExpectedAlleleFraction        (Internal) Annotate a vcf with expected allele fractions in pooled sequencing
    CalculateGenotypePosteriors                  Calculate genotype posterior probabilities given family and/or known population genotypes
    CalculateMixingFractions                     (Internal) Calculate proportions of different samples in a pooled bam
    Concordance                                  Evaluate concordance of an input VCF against a validated truth VCF
    CountFalsePositives                          (BETA Tool) Count PASS variants
    CountVariants                                Counts variant records in a VCF file, regardless of filter status.
    CountVariantsSpark                           CountVariants on Spark
    EvaluateInfoFieldConcordance                 (BETA Tool) Evaluate concordance of info fields in an input VCF against a validated truth VCF
    FilterFuncotations                           (EXPERIMENTAL Tool) Filter variants based on clinically-significant Funcotations.
    FindMendelianViolations (Picard)             Finds mendelian violations of all types within a VCF
    FuncotateSegments                            (BETA Tool) Functional annotation for segment files.  The output formats are not well-defined and subject to change.
    Funcotator                                   Functional Annotator
    FuncotatorDataSourceDownloader               Data source downloader for Funcotator.
    GenotypeConcordance (Picard)                 Calculates the concordance between genotype data of one sample in each of two VCFs - truth (or reference) vs. calls.
    MergeMutect2CallsWithMC3                     (EXPERIMENTAL Tool) UNSUPPORTED.  FOR EVALUATION ONLY. Merge M2 calls with MC
    ReferenceBlockConcordance                    Evaluate GVCF reference block concordance of an input GVCF against a truth GVCF
    ValidateBasicSomaticShortMutations           (EXPERIMENTAL Tool) Check variants against tumor-normal bams representing the same samples, though not the ones from the actual calls.
    ValidateVariants                             Validate VCF
    VariantEval                                  (BETA Tool) General-purpose tool for variant evaluation (% in dbSNP, genotype concordance, Ti/Tv ratios, and a lot more)
    VariantsToTable                              Extract fields from a VCF file to a tab-delimited table

--------------------------------------------------------------------------------------
Variant Filtering:                               Tools that filter variants by annotating the FILTER column
    ApplyVQSR                                     Apply a score cutoff to filter variants based on a recalibration table
    CNNScoreVariants                             Apply a Convolutional Neural Net to filter annotated variants
    CNNVariantTrain                              (EXPERIMENTAL Tool) Train a CNN model for filtering variants
    CNNVariantWriteTensors                       (EXPERIMENTAL Tool) Write variant tensors for training a CNN to filter variants
    CreateSomaticPanelOfNormals                  (BETA Tool) Make a panel of normals for use with Mutect2
    ExtractVariantAnnotations                    (BETA Tool) Extracts site-level variant annotations, labels, and other metadata from a VCF file to HDF5 files
    FilterAlignmentArtifacts                     (EXPERIMENTAL Tool) Filter alignment artifacts from a vcf callset.
    FilterMutectCalls                            Filter somatic SNVs and indels called by Mutect2
    FilterVariantTranches                        Apply tranche filtering
    FilterVcf (Picard)                           Hard filters a VCF.
    MTLowHeteroplasmyFilterTool                  If too many low het sites, filter all low het sites
    NuMTFilterTool                               Uses the median autosomal coverage and the allele depth to determine whether the allele might be a NuMT
    ScoreVariantAnnotations                      (BETA Tool) Scores variant calls in a VCF file based on site-level annotations using a previously trained model
    TrainVariantAnnotationsModel                 (BETA Tool) Trains a model for scoring variant calls based on site-level annotations
    VariantFiltration                            Filter variant calls based on INFO and/or FORMAT annotations
    VariantRecalibrator                          Build a recalibration model to score variant quality for filtering purposes

--------------------------------------------------------------------------------------
Variant Manipulation:                            Tools that manipulate variant call format (VCF) data
    FixVcfHeader (Picard)                        Replaces or fixes a VCF header.
    GatherVcfs (Picard)                          Gathers multiple VCF files from a scatter operation into a single VCF file
    GatherVcfsCloud                              (BETA Tool) Gathers multiple VCF files from a scatter operation into a single VCF file
    LeftAlignAndTrimVariants                     Left align and trim vairants
    LiftoverVcf (Picard)                         Lifts over a VCF file from one reference build to another.  
    MakeSitesOnlyVcf (Picard)                    Creates a VCF that contains all the site-level information for all records in the input VCF but no genotype information.
    MakeVcfSampleNameMap (Picard)                Creates a TSV from sample name to VCF/GVCF path, with one line per input.
    MergeVcfs (Picard)                           Combines multiple variant files into a single variant file
    PrintVariantsSpark                           Prints out variants from the input VCF.
    RemoveNearbyIndels                           (Internal) Remove indels from the VCF file that are close to each other.
    RenameSampleInVcf (Picard)                   Renames a sample within a VCF or BCF.
    SelectVariants                               Select a subset of variants from a VCF file
    SortVcf (Picard)                             Sorts one or more VCF files.  
    SplitVcfs (Picard)                           Splits SNPs and INDELs into separate files.  
    UpdateVCFSequenceDictionary                  Updates the sequence dictionary in a variant file.
    UpdateVcfSequenceDictionary (Picard)         Takes a VCF and a second file that contains a sequence dictionary and updates the VCF with the new sequence dictionary.
    VariantAnnotator                             Tool for adding annotations to VCF files
    VcfFormatConverter (Picard)                  Converts VCF to BCF or BCF to VCF.  
    VcfToIntervalList (Picard)                   Converts a VCF or BCF file to a Picard Interval List

--------------------------------------------------------------------------------------

***********************************************************************

A USER ERROR has occurred: '-Xmx104857M' is not a valid command.


***********************************************************************
Set the system property GATK_STACKTRACE_ON_USER_EXCEPTION (--java-options '-DGATK_STACKTRACE_ON_USER_EXCEPTION=true') to print the stack trace.
Using GATK jar /gatk/gatk-package-4.3.0.0-local.jar
Running:
    java -Dsamjdk.use_async_io_read_samtools=false -Dsamjdk.use_async_io_write_samtools=true -Dsamjdk.use_async_io_write_tribble=false -Dsamjdk.compression_level=2 -jar /gatk/gatk-package-4.3.0.0-local.jar -Xmx104857M SplitNCigarReads -R input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta -I output.temp/Le1-13-502-701_1.fastq.gz_addrg_repN.bam -O output2/Le1-13-502-701_1.fastq.gz.bam
/usr/local/bin/picard: line 5: warning: setlocale: LC_ALL: cannot change locale (en_US.UTF-8): No such file or directory
INFO	2023-02-28 23:40:56	AddOrReplaceReadGroups	

********** NOTE: Picard's command line syntax is changing.
**********
********** For more information, please see:
********** https://github.com/broadinstitute/picard/wiki/Command-Line-Syntax-Transition-For-Users-(Pre-Transition)
**********
********** The command line looks like this in the new syntax:
**********
**********    AddOrReplaceReadGroups -I output/Le1-17-502-703_1.fastq.gz.bam -O output.temp/Le1-17-502-703_1.fastq.gz_addrg.bam -SO coordinate -RGID Le1-17-502-703_1.fastq.gz -RGLB library -RGPL Illumina -RGPU Illumina -RGSM Le1-17-502-703_1.fastq.gz
**********


23:40:57.347 INFO  NativeLibraryLoader - Loading libgkl_compression.so from jar:file:/usr/local/share/picard-2.18.27-0/picard.jar!/com/intel/gkl/native/libgkl_compression.so
[Tue Feb 28 23:40:57 GMT 2023] AddOrReplaceReadGroups INPUT=output/Le1-17-502-703_1.fastq.gz.bam OUTPUT=output.temp/Le1-17-502-703_1.fastq.gz_addrg.bam SORT_ORDER=coordinate RGID=Le1-17-502-703_1.fastq.gz RGLB=library RGPL=Illumina RGPU=Illumina RGSM=Le1-17-502-703_1.fastq.gz    VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false GA4GH_CLIENT_SECRETS=client_secrets.json USE_JDK_DEFLATER=false USE_JDK_INFLATER=false
[Tue Feb 28 23:40:57 GMT 2023] Executing as ?@4855180c684a on Linux 3.10.0-1160.36.2.el7.x86_64 amd64; OpenJDK 64-Bit Server VM 11.0.1+13-LTS; Deflater: Intel; Inflater: Intel; Provider GCS is not available; Picard version: 2.18.27-SNAPSHOT
INFO	2023-02-28 23:40:57	AddOrReplaceReadGroups	Created read-group ID=Le1-17-502-703_1.fastq.gz PL=Illumina LB=library SM=Le1-17-502-703_1.fastq.gz

[Tue Feb 28 23:41:10 GMT 2023] picard.sam.AddOrReplaceReadGroups done. Elapsed time: 0.22 minutes.
Runtime.totalMemory()=2583691264
USAGE:   [-h]

Available Programs:
--------------------------------------------------------------------------------------
Base Calling:                                    Tools that process sequencing machine data, e.g. Illumina base calls, and detect sequencing level attributes, e.g. adapters
    CheckIlluminaDirectory (Picard)              Asserts the validity for specified Illumina basecalling data.  
    CollectIlluminaBasecallingMetrics (Picard)   Collects Illumina Basecalling metrics for a sequencing run.  
    CollectIlluminaLaneMetrics (Picard)          Collects Illumina lane metrics for the given BaseCalling analysis directory.
    ExtractIlluminaBarcodes (Picard)             Tool determines the barcode for each read in an Illumina lane.  
    IlluminaBasecallsToFastq (Picard)            Generate FASTQ file(s) from Illumina basecall read data.  
    IlluminaBasecallsToSam (Picard)              Transforms raw Illumina sequencing data into an unmapped SAM, BAM or CRAM file.
    MarkIlluminaAdapters (Picard)                Reads a SAM/BAM/CRAM file and rewrites it with new adapter-trimming tags.  

--------------------------------------------------------------------------------------
Copy Number Variant Discovery:                   Tools that analyze read coverage to detect copy number variants.
    AnnotateIntervals                            Annotates intervals with GC content, mappability, and segmental-duplication content
    CallCopyRatioSegments                        Calls copy-ratio segments as amplified, deleted, or copy-number neutral
    CombineSegmentBreakpoints                    (EXPERIMENTAL Tool) Combine the breakpoints of two segment files and annotate the resulting intervals with chosen columns from each file.
    CreateReadCountPanelOfNormals                Creates a panel of normals for read-count denoising
    DenoiseReadCounts                            Denoises read counts to produce denoised copy ratios
    DetermineGermlineContigPloidy                Determines the baseline contig ploidy for germline samples given counts data
    FilterIntervals                              Filters intervals based on annotations and/or count statistics
    GermlineCNVCaller                            Calls copy-number variants in germline samples given their counts and the output of DetermineGermlineContigPloidy
    MergeAnnotatedRegions                        (EXPERIMENTAL Tool) Merge annotated genomic regions based entirely on touching/overlapping intervals.
    MergeAnnotatedRegionsByAnnotation            (EXPERIMENTAL Tool) Merge annotated genomic regions within specified distance if annotation value(s) are exactly the same.
    ModelSegments                                Models segmented copy ratios from denoised copy ratios and segmented minor-allele fractions from allelic counts
    PlotDenoisedCopyRatios                       Creates plots of denoised copy ratios
    PlotModeledSegments                          Creates plots of denoised and segmented copy-ratio and minor-allele-fraction estimates
    PostprocessGermlineCNVCalls                  Postprocesses the output of GermlineCNVCaller and generates VCFs and denoised copy ratios
    TagGermlineEvents                            (EXPERIMENTAL Tool) Do a simplistic tagging of germline events in a tumor segment file.

--------------------------------------------------------------------------------------
Coverage Analysis:                               Tools that count coverage, e.g. depth per allele
    ASEReadCounter                               Generates table of filtered base counts at het sites for allele specific expression
    AnalyzeSaturationMutagenesis                 (BETA Tool) (EXPERIMENTAL) Processes reads from a MITESeq or other saturation mutagenesis experiment.
    CollectAllelicCounts                         Collects reference and alternate allele counts at specified sites
    CollectAllelicCountsSpark                    Collects reference and alternate allele counts at specified sites
    CollectF1R2Counts                            Collect F1R2 read counts for the Mutect2 orientation bias mixture model filter
    CollectReadCounts                            Collects read counts at specified intervals
    CountBases                                   Count bases in a SAM/BAM/CRAM file
    CountBasesSpark                              Counts bases in the input SAM/BAM
    CountReads                                   Count reads in a SAM/BAM/CRAM file
    CountReadsSpark                              Counts reads in the input SAM/BAM
    DepthOfCoverage                              (BETA Tool) Generate coverage summary information for reads data
    GatherNormalArtifactData                     Combine output files from GetNormalArtifactData in the order defined by a sequence dictionary
    GeneExpressionEvaluation                     (BETA Tool) Evaluate gene expression from RNA-seq reads aligned to genome.
    GetNormalArtifactData                        Collects data for training normal artifact filter
    GetPileupSummaries                           Tabulates pileup metrics for inferring contamination
    LocalAssembler                               (BETA Tool) Local assembler for SVs
    Pileup                                       Prints read alignments in samtools pileup format
    PileupSpark                                  (BETA Tool) Prints read alignments in samtools pileup format

--------------------------------------------------------------------------------------
Diagnostics and Quality Control:                 Tools that collect sequencing quality related and comparative metrics
    AccumulateQualityYieldMetrics (Picard)       Combines multiple QualityYieldMetrics files into a single file.
    AccumulateVariantCallingMetrics (Picard)     Combines multiple Variant Calling Metrics files into a single file
    AnalyzeCovariates                            Evaluate and compare base quality score recalibration (BQSR) tables
    BamIndexStats (Picard)                       Generate index statistics from a BAM file
    CalcMetadataSpark                            (BETA Tool) (Internal) Collects read metrics relevant to structural variant discovery
    CalculateContamination                       Calculate the fraction of reads coming from cross-sample contamination
    CalculateFingerprintMetrics (Picard)         Calculate statistics on fingerprints, checking their viability
    CalculateReadGroupChecksum (Picard)          Creates a hash code based on the read groups (RG).  
    CheckDuplicateMarking (Picard)               Checks the consistency of duplicate markings.
    CheckFingerprint (Picard)                    Computes a fingerprint from the supplied input (SAM/BAM/CRAM or VCF) file and compares it to the provided genotypes
    CheckPileup                                  Compare GATK's internal pileup to a reference Samtools mpileup
    CheckTerminatorBlock (Picard)                Asserts the provided gzip file's (e.g., BAM) last block is well-formed; RC 100 otherwise
    ClusterCrosscheckMetrics (Picard)            Clusters the results of a CrosscheckFingerprints run by LOD score
    CollectAlignmentSummaryMetrics (Picard)      Produces a summary of alignment metrics from a SAM or BAM file.  
    CollectArraysVariantCallingMetrics (Picard)  Collects summary and per-sample from the provided arrays VCF file
    CollectBaseDistributionByCycle (Picard)      Chart the nucleotide distribution per cycle in a SAM or BAM file
    CollectBaseDistributionByCycleSpark          (BETA Tool) Collects base distribution per cycle in SAM/BAM/CRAM file(s).
    CollectGcBiasMetrics (Picard)                Collect metrics regarding GC bias. 
    CollectHiSeqXPfFailMetrics (Picard)          Classify PF-Failing reads in a HiSeqX Illumina Basecalling directory into various categories.
    CollectHsMetrics (Picard)                    Collects hybrid-selection (HS) metrics for a SAM or BAM file.  
    CollectIndependentReplicateMetrics (Picard)  (EXPERIMENTAL Tool) Estimates the rate of independent replication rate of reads within a bam. 

    CollectInsertSizeMetrics (Picard)            Collect metrics about the insert size distribution of a paired-end library. 
    CollectInsertSizeMetricsSpark                (BETA Tool) Collects insert size distribution information on alignment data
    CollectJumpingLibraryMetrics (Picard)        Collect jumping library metrics. 
    CollectMultipleMetrics (Picard)              Collect multiple classes of metrics. 
    CollectMultipleMetricsSpark                  (BETA Tool) Runs multiple metrics collection modules for a given alignment file
    CollectOxoGMetrics (Picard)                  Collect metrics to assess oxidative artifacts.
    CollectQualityYieldMetrics (Picard)          Collect metrics about reads that pass quality thresholds and Illumina-specific filters.  
    CollectQualityYieldMetricsSpark              (BETA Tool) Collects quality yield metrics from SAM/BAM/CRAM file(s).
    CollectRawWgsMetrics (Picard)                Collect whole genome sequencing-related metrics.  
    CollectRnaSeqMetrics (Picard)                Produces RNA alignment metrics for a SAM or BAM file.  
    CollectRrbsMetrics (Picard)                  Collects metrics from reduced representation bisulfite sequencing (Rrbs) data.  
    CollectSamErrorMetrics (Picard)              Program to collect error metrics on bases stratified in various ways.
    CollectSequencingArtifactMetrics (Picard)    Collect metrics to quantify single-base sequencing artifacts.  
    CollectTargetedPcrMetrics (Picard)           Calculate PCR-related metrics from targeted sequencing data. 
    CollectVariantCallingMetrics (Picard)        Collects per-sample and aggregate (spanning all samples) metrics from the provided VCF file
    CollectWgsMetrics (Picard)                   Collect metrics about coverage and performance of whole genome sequencing (WGS) experiments.
    CollectWgsMetricsWithNonZeroCoverage (Picard)(EXPERIMENTAL Tool) Collect metrics about coverage and performance of whole genome sequencing (WGS) experiments.  
    CompareBaseQualities                         Compares the base qualities of two SAM/BAM/CRAM files
    CompareDuplicatesSpark                       (BETA Tool) Determine if two potentially identical BAMs have the same duplicate reads
    CompareMetrics (Picard)                      Compare two metrics files.
    CompareSAMs (Picard)                         Compare two input SAM/BAM/CRAM files.  
    ConvertHaplotypeDatabaseToVcf (Picard)       Convert Haplotype database file to vcf
    ConvertSequencingArtifactToOxoG (Picard)     Extract OxoG metrics from generalized artifacts metrics.  
    CrosscheckFingerprints (Picard)              Checks that all data in the input files appear to have come from the same individual
    CrosscheckReadGroupFingerprints (Picard)     DEPRECATED: USE CrosscheckFingerprints. 
    DumpTabixIndex                               Dumps a tabix index file.
    EstimateLibraryComplexity (Picard)           Estimates the numbers of unique molecules in a sequencing library.  
    ExtractFingerprint (Picard)                  Computes a fingerprint from the input file.
    FlagStat                                     Accumulate flag statistics given a BAM file
    FlagStatSpark                                Spark tool to accumulate flag statistics
    GatherPileupSummaries                        Combine output files from GetPileupSummary in the order defined by a sequence dictionary
    GetSampleName                                Emit a single sample name
    IdentifyContaminant (Picard)                 Computes a fingerprint from the supplied SAM/BAM file, given a contamination estimate.
    LiftOverHaplotypeMap (Picard)                Lifts over a haplotype database from one reference to another
    MeanQualityByCycle (Picard)                  Collect mean quality by cycle.
    MeanQualityByCycleSpark                      (BETA Tool) MeanQualityByCycle on Spark
    QualityScoreDistribution (Picard)            Chart the distribution of quality scores.  
    QualityScoreDistributionSpark                (BETA Tool) QualityScoreDistribution on Spark
    ValidateSamFile (Picard)                     Validates a SAM/BAM/CRAM file.
    ViewSam (Picard)                             Prints a SAM or BAM file to the screen

--------------------------------------------------------------------------------------
Example Tools:                                   Example tools that show developers how to implement new tools
    ExampleMultiFeatureWalker                    Example of a MultiFeatureWalker subclass.
    HtsgetReader                                 (EXPERIMENTAL Tool) Download a file using htsget

--------------------------------------------------------------------------------------
Flow Based Tools:                                Tools designed specifically to operate on flow based data
    CalculateAverageCombinedAnnotations          (EXPERIMENTAL Tool) Divides annotations that were summed by genomicsDB by number of samples to calculate average.
    FlowFeatureMapper                            (EXPERIMENTAL Tool) Map/find features in BAM file, output VCF. Initially mapping SNVs
    GroundTruthReadsBuilder                      (EXPERIMENTAL Tool) Produces a flexible and robust ground truth set for base calling training
    SplitCRAM                                    (EXPERIMENTAL Tool) Split CRAM files to smaller files efficiently

--------------------------------------------------------------------------------------
Genotyping Arrays Manipulation:                  Tools that manipulate data generated by Genotyping arrays
    BpmToNormalizationManifestCsv (Picard)       Program to convert an Illumina bpm file into a bpm.csv file.
    CombineGenotypingArrayVcfs (Picard)          Program to combine multiple genotyping array VCF files into one VCF.
    CompareGtcFiles (Picard)                     Compares two GTC files.
    CreateBafRegressMetricsFile (Picard)         Program to generate a picard metrics file from the output of the bafRegress tool.
    CreateExtendedIlluminaManifest (Picard)      Create an Extended Illumina Manifest for usage by the Picard tool GtcToVcf
    CreateVerifyIDIntensityContaminationMetricsFile (Picard)    Program to generate a picard metrics file from the output of the VerifyIDIntensity tool.
    GtcToVcf (Picard)                            Program to convert an Illumina GTC file to a VCF
    MergePedIntoVcf (Picard)                     Program to merge a single-sample ped file from zCall into a single-sample VCF.
    VcfToAdpc (Picard)                           Program to convert an Arrays VCF to an ADPC file.

--------------------------------------------------------------------------------------
Intervals Manipulation:                          Tools that process genomic intervals in various formats
    BedToIntervalList (Picard)                   Converts a BED file to a Picard Interval List.  
    CompareIntervalLists                         Compare two interval lists for equality
    IntervalListToBed (Picard)                   Converts an Picard IntervalList file to a BED file.
    IntervalListTools (Picard)                   A tool for performing various IntervalList manipulations
    LiftOverIntervalList (Picard)                Lifts over an interval list from one reference build to another. 
    PreprocessIntervals                          Prepares bins for coverage collection
    SplitIntervals                               Split intervals into sub-interval files.

--------------------------------------------------------------------------------------
Metagenomics:                                    Tools that perform metagenomic analysis, e.g. microbial community composition and pathogen detection
    PathSeqBuildKmers                            Builds set of host reference k-mers
    PathSeqBuildReferenceTaxonomy                Builds a taxonomy datafile of the microbe reference
    PathSeqBwaSpark                              Step 2: Aligns reads to the microbe reference
    PathSeqFilterSpark                           Step 1: Filters low quality, low complexity, duplicate, and host reads
    PathSeqPipelineSpark                         Combined tool that performs all steps: read filtering, microbe reference alignment, and abundance scoring
    PathSeqScoreSpark                            Step 3: Classifies pathogen-aligned reads and generates abundance scores

--------------------------------------------------------------------------------------
Methylation-Specific Tools:                      Tools that perform methylation calling, processing bisulfite sequenced, methylation-aware aligned BAM
    MethylationTypeCaller                        (EXPERIMENTAL Tool) Identify methylated bases from bisulfite sequenced, methylation-aware BAMs

--------------------------------------------------------------------------------------
Other:                                           Miscellaneous tools, e.g. those that aid in data streaming
    CreateHadoopBamSplittingIndex                (BETA Tool) Create a Hadoop BAM splitting index
    FifoBuffer (Picard)                          Provides a large, FIFO buffer that can be used to buffer input and output streams between programs.
    GatherBQSRReports                            Gathers scattered BQSR recalibration reports into a single file
    GatherTranches                               (BETA Tool) Gathers scattered VQSLOD tranches into a single file
    IndexFeatureFile                             Creates an index for a feature file, e.g. VCF or BED file.
    ParallelCopyGCSDirectoryIntoHDFSSpark        (BETA Tool) Parallel copy a file or directory from Google Cloud Storage into the HDFS file system used by Spark
    PrintBGZFBlockInformation                    (EXPERIMENTAL Tool) Print information about the compressed blocks in a BGZF format file
    ReadAnonymizer                               (EXPERIMENTAL Tool) Replace bases in reads with reference bases.
    ReblockGVCF                                  Condenses homRef blocks in a single-sample GVCF
    SortGff (Picard)                             Sorts a gff3 file, and adds flush directives

--------------------------------------------------------------------------------------
Read Data Manipulation:                          Tools that manipulate read data in SAM, BAM or CRAM format
    AddCommentsToBam (Picard)                    Adds comments to the header of a BAM file.
    AddOATag (Picard)                            Record current alignment information to OA tag.
    AddOrReplaceReadGroups (Picard)              Assigns all the reads in a file to a single new read-group.
    AddOriginalAlignmentTags                     (EXPERIMENTAL Tool) Adds Original Alignment tag and original mate contig tag
    ApplyBQSR                                    Apply base quality score recalibration
    ApplyBQSRSpark                               (BETA Tool) Apply base quality score recalibration on Spark
    BQSRPipelineSpark                            (BETA Tool) Both steps of BQSR (BaseRecalibrator and ApplyBQSR) on Spark
    BamToBfq (Picard)                            Converts a BAM file into a BFQ (binary fastq formatted) file
    BaseRecalibrator                             Generates recalibration table for Base Quality Score Recalibration (BQSR)
    BaseRecalibratorSpark                        (BETA Tool) Generate recalibration table for Base Quality Score Recalibration (BQSR) on Spark
    BuildBamIndex (Picard)                       Generates a BAM index ".bai" file.  
    BwaAndMarkDuplicatesPipelineSpark            (BETA Tool) Takes name-sorted file and runs BWA and MarkDuplicates.
    BwaSpark                                     (BETA Tool) Align reads to a given reference using BWA on Spark
    CleanSam (Picard)                            Cleans a SAM/BAM/CRAM files, soft-clipping beyond-end-of-reference alignments and setting MAPQ to 0 for unmapped reads
    ClipReads                                    Clip reads in a SAM/BAM/CRAM file
    CollectDuplicateMetrics (Picard)             Collect Duplicate metrics from marked file.
    ConvertHeaderlessHadoopBamShardToBam         (BETA Tool) Convert a headerless BAM shard into a readable BAM
    DownsampleByDuplicateSet                     (BETA Tool) Discard a set fraction of duplicate sets from a UMI-grouped bam
    DownsampleSam (Picard)                       Downsample a SAM or BAM file.
    ExtractOriginalAlignmentRecordsByNameSpark   (BETA Tool) Subsets reads by name
    FastqToSam (Picard)                          Converts a FASTQ file to an unaligned BAM or SAM file
    FilterSamReads (Picard)                      Subsets reads from a SAM/BAM/CRAM file by applying one of several filters.
    FixMateInformation (Picard)                  Verify mate-pair information between mates and fix if needed.
    FixMisencodedBaseQualityReads                Fix Illumina base quality scores in a SAM/BAM/CRAM file
    GatherBamFiles (Picard)                      Concatenate efficiently BAM files that resulted from a scattered parallel analysis
    LeftAlignIndels                              Left-aligns indels from reads in a SAM/BAM/CRAM file
    MarkDuplicates (Picard)                      Identifies duplicate reads.  
    MarkDuplicatesSpark                          MarkDuplicates on Spark
    MarkDuplicatesWithMateCigar (Picard)         Identifies duplicate reads, accounting for mate CIGAR.  
    MergeBamAlignment (Picard)                   Merge alignment data from a SAM or BAM with data in an unmapped BAM file.  
    MergeSamFiles (Picard)                       Merges multiple SAM/BAM/CRAM (and/or) files into a single file.  
    PositionBasedDownsampleSam (Picard)          Downsample a SAM or BAM file to retain a subset of the reads based on the reads location in each tile in the flowcell.
    PostProcessReadsForRSEM                      (BETA Tool) Reorder reads before running RSEM
    PrintDistantMates                            Unmaps reads with distant mates.
    PrintReads                                   Print reads in the SAM/BAM/CRAM file
    PrintReadsHeader                             Print the header from a SAM/BAM/CRAM file
    PrintReadsSpark                              PrintReads on Spark
    ReorderSam (Picard)                          Reorders reads in a SAM or BAM file to match ordering in a second reference file.
    ReplaceSamHeader (Picard)                    Replaces the SAMFileHeader in a SAM/BAM/CRAM file.  
    RevertBaseQualityScores                      Revert Quality Scores in a SAM/BAM/CRAM file
    RevertOriginalBaseQualitiesAndAddMateCigar (Picard)Reverts the original base qualities and adds the mate cigar tag to read-group files
    RevertSam (Picard)                           Reverts SAM/BAM/CRAM files to a previous state.  
    RevertSamSpark                               (BETA Tool) Reverts SAM, BAM or CRAM files to a previous state.
    SamFormatConverter (Picard)                  Convert a BAM file to a SAM file, or a SAM to a BAM
    SamToFastq (Picard)                          Converts a SAM/BAM/CRAM file to FASTQ.
    SamToFastqWithTags (Picard)                  Converts a SAM or BAM file to FASTQ alongside FASTQs created from tags.
    SetNmAndUqTags (Picard)                      DEPRECATED: Use SetNmMdAndUqTags instead.
    SetNmMdAndUqTags (Picard)                    Fixes the NM, MD, and UQ tags in a SAM/BAM/CRAM file 
    SimpleMarkDuplicatesWithMateCigar (Picard)   (EXPERIMENTAL Tool) Examines aligned records in the supplied SAM or BAM file to locate duplicate molecules.
    SortSam (Picard)                             Sorts a SAM, BAM or CRAM file.  
    SortSamSpark                                 (BETA Tool) SortSam on Spark (works on SAM/BAM/CRAM)
    SplitNCigarReads                             Split Reads with N in Cigar
    SplitReads                                   Outputs reads from a SAM/BAM/CRAM by read group, sample and library name
    SplitSamByLibrary (Picard)                   Splits a SAM/BAM/CRAM file into individual files by library
    SplitSamByNumberOfReads (Picard)             Splits a SAM/BAM/CRAM file to multiple files.
    TransferReadTags                             (EXPERIMENTAL Tool) Incorporate read tags in a SAM file to that of a matching SAM file
    UmiAwareMarkDuplicatesWithMateCigar (Picard) (EXPERIMENTAL Tool) Identifies duplicate reads using information from read positions and UMIs. 
    UnmarkDuplicates                             Clears the 0x400 duplicate SAM flag

--------------------------------------------------------------------------------------
Reference:                                       Tools that analyze and manipulate FASTA format references
    BaitDesigner (Picard)                        Designs oligonucleotide baits for hybrid selection reactions.
    BwaMemIndexImageCreator                      Create a BWA-MEM index image file for use with GATK BWA tools
    CheckReferenceCompatibility                  (EXPERIMENTAL Tool) Check a BAM/VCF for compatibility against specified references.
    CompareReferences                            (EXPERIMENTAL Tool) Display reference comparison as a tab-delimited table and summarize reference differences.
    ComposeSTRTableFile                          Composes a genome-wide STR location table used for DragSTR model auto-calibration
    CountBasesInReference                        Count the numbers of each base in a reference file
    CreateSequenceDictionary (Picard)            Creates a sequence dictionary for a reference sequence.  
    ExtractSequences (Picard)                    Subsets intervals from a reference sequence to a new FASTA file.
    FastaAlternateReferenceMaker                 Create an alternative reference by combining a fasta with a vcf.
    FastaReferenceMaker                          Create snippets of a fasta file
    FindBadGenomicKmersSpark                     (BETA Tool) Identifies sequences that occur at high frequency in a reference
    NonNFastaSize (Picard)                       Counts the number of non-N bases in a fasta file.
    NormalizeFasta (Picard)                      Normalizes lines of sequence in a FASTA file to be of the same length.
    ScatterIntervalsByNs (Picard)                Writes an interval list created by splitting a reference at Ns.
    ShiftFasta                                   (BETA Tool) Creates a shifted fasta file and shift_back file

--------------------------------------------------------------------------------------
Short Variant Discovery:                         Tools that perform variant calling and genotyping for short variants (SNPs, SNVs and Indels)
    CalibrateDragstrModel                        estimates the parameters for the DRAGstr model
    CombineGVCFs                                 Merges one or more HaplotypeCaller GVCF files into a single GVCF with appropriate annotations
    GenomicsDBImport                             Import VCFs to GenomicsDB
    GenotypeGVCFs                                Perform joint genotyping on one or more samples pre-called with HaplotypeCaller
    GnarlyGenotyper                              (BETA Tool) Perform "quick and dirty" joint genotyping on one or more samples pre-called with HaplotypeCaller
    HaplotypeBasedVariantRecaller                (EXPERIMENTAL Tool) Calculate likelihood matrix for each Allele in VCF against a set of Reads limited by a set of Haplotypes
    HaplotypeCaller                              Call germline SNPs and indels via local re-assembly of haplotypes
    HaplotypeCallerSpark                         (BETA Tool) HaplotypeCaller on Spark
    LearnReadOrientationModel                    Get the maximum likelihood estimates of artifact prior probabilities in the orientation bias mixture model filter
    MergeMutectStats                             Merge the stats output by scatters of a single Mutect2 job
    Mutect2                                      Call somatic SNVs and indels via local assembly of haplotypes
    RampedHaplotypeCaller                        (EXPERIMENTAL Tool) Call germline SNPs and indels via local re-assembly of haplotypes (ramped version)
    ReadsPipelineSpark                           (BETA Tool) Runs BWA (if specified), MarkDuplicates, BQSR, and HaplotypeCaller on unaligned or aligned reads to generate a VCF.

--------------------------------------------------------------------------------------
Structural Variant Discovery:                    Tools that detect structural variants        
    CollectSVEvidence                            (BETA Tool) Gathers paired-end and split read evidence files for use in the GATK-SV pipeline.
    CondenseDepthEvidence                        (EXPERIMENTAL Tool) Merges adjacent DepthEvidence records.
    CpxVariantReInterpreterSpark                 (BETA Tool) (Internal) Tries to extract simple variants from a provided GATK-SV CPX.vcf
    DiscoverVariantsFromContigAlignmentsSAMSpark (BETA Tool) (Internal) Examines aligned contigs from local assemblies and calls structural variants
    ExtractSVEvidenceSpark                       (BETA Tool) (Internal) Extracts evidence of structural variations from reads
    FindBreakpointEvidenceSpark                  (BETA Tool) (Internal) Produces local assemblies of genomic regions that may harbor structural variants
    JointGermlineCNVSegmentation                 (BETA Tool) Combine segmented gCNV VCFs.
    PrintReadCounts                              (EXPERIMENTAL Tool) Prints count files for CNV determination.
    PrintSVEvidence                              (EXPERIMENTAL Tool) Merges SV evidence records.
    SVAnnotate                                   Adds gene overlap and variant consequence annotations to SV VCF from GATK-SV pipeline
    SVCluster                                    (BETA Tool) Clusters structural variants
    SiteDepthtoBAF                               (EXPERIMENTAL Tool) Convert SiteDepth to BafEvidence
    StructuralVariantDiscoverer                  (BETA Tool) (Internal) Examines aligned contigs from local assemblies and calls structural variants or their breakpoints
    StructuralVariationDiscoveryPipelineSpark    (BETA Tool) Runs the structural variation discovery workflow on a single sample
    SvDiscoverFromLocalAssemblyContigAlignmentsSpark    (BETA Tool) (Internal) Examines aligned contigs from local assemblies and calls structural variants or their breakpoints

--------------------------------------------------------------------------------------
Variant Evaluation and Refinement:               Tools that evaluate and refine variant calls, e.g. with annotations not offered by the engine
    AlleleFrequencyQC                            (BETA Tool) General-purpose tool for variant evaluation (% in dbSNP, genotype concordance, Ti/Tv ratios, and a lot more)
    AnnotateVcfWithBamDepth                      (Internal) Annotate a vcf with a bam's read depth at each variant locus
    AnnotateVcfWithExpectedAlleleFraction        (Internal) Annotate a vcf with expected allele fractions in pooled sequencing
    CalculateGenotypePosteriors                  Calculate genotype posterior probabilities given family and/or known population genotypes
    CalculateMixingFractions                     (Internal) Calculate proportions of different samples in a pooled bam
    Concordance                                  Evaluate concordance of an input VCF against a validated truth VCF
    CountFalsePositives                          (BETA Tool) Count PASS variants
    CountVariants                                Counts variant records in a VCF file, regardless of filter status.
    CountVariantsSpark                           CountVariants on Spark
    EvaluateInfoFieldConcordance                 (BETA Tool) Evaluate concordance of info fields in an input VCF against a validated truth VCF
    FilterFuncotations                           (EXPERIMENTAL Tool) Filter variants based on clinically-significant Funcotations.
    FindMendelianViolations (Picard)             Finds mendelian violations of all types within a VCF
    FuncotateSegments                            (BETA Tool) Functional annotation for segment files.  The output formats are not well-defined and subject to change.
    Funcotator                                   Functional Annotator
    FuncotatorDataSourceDownloader               Data source downloader for Funcotator.
    GenotypeConcordance (Picard)                 Calculates the concordance between genotype data of one sample in each of two VCFs - truth (or reference) vs. calls.
    MergeMutect2CallsWithMC3                     (EXPERIMENTAL Tool) UNSUPPORTED.  FOR EVALUATION ONLY. Merge M2 calls with MC
    ReferenceBlockConcordance                    Evaluate GVCF reference block concordance of an input GVCF against a truth GVCF
    ValidateBasicSomaticShortMutations           (EXPERIMENTAL Tool) Check variants against tumor-normal bams representing the same samples, though not the ones from the actual calls.
    ValidateVariants                             Validate VCF
    VariantEval                                  (BETA Tool) General-purpose tool for variant evaluation (% in dbSNP, genotype concordance, Ti/Tv ratios, and a lot more)
    VariantsToTable                              Extract fields from a VCF file to a tab-delimited table

--------------------------------------------------------------------------------------
Variant Filtering:                               Tools that filter variants by annotating the FILTER column
    ApplyVQSR                                     Apply a score cutoff to filter variants based on a recalibration table
    CNNScoreVariants                             Apply a Convolutional Neural Net to filter annotated variants
    CNNVariantTrain                              (EXPERIMENTAL Tool) Train a CNN model for filtering variants
    CNNVariantWriteTensors                       (EXPERIMENTAL Tool) Write variant tensors for training a CNN to filter variants
    CreateSomaticPanelOfNormals                  (BETA Tool) Make a panel of normals for use with Mutect2
    ExtractVariantAnnotations                    (BETA Tool) Extracts site-level variant annotations, labels, and other metadata from a VCF file to HDF5 files
    FilterAlignmentArtifacts                     (EXPERIMENTAL Tool) Filter alignment artifacts from a vcf callset.
    FilterMutectCalls                            Filter somatic SNVs and indels called by Mutect2
    FilterVariantTranches                        Apply tranche filtering
    FilterVcf (Picard)                           Hard filters a VCF.
    MTLowHeteroplasmyFilterTool                  If too many low het sites, filter all low het sites
    NuMTFilterTool                               Uses the median autosomal coverage and the allele depth to determine whether the allele might be a NuMT
    ScoreVariantAnnotations                      (BETA Tool) Scores variant calls in a VCF file based on site-level annotations using a previously trained model
    TrainVariantAnnotationsModel                 (BETA Tool) Trains a model for scoring variant calls based on site-level annotations
    VariantFiltration                            Filter variant calls based on INFO and/or FORMAT annotations
    VariantRecalibrator                          Build a recalibration model to score variant quality for filtering purposes

--------------------------------------------------------------------------------------
Variant Manipulation:                            Tools that manipulate variant call format (VCF) data
    FixVcfHeader (Picard)                        Replaces or fixes a VCF header.
    GatherVcfs (Picard)                          Gathers multiple VCF files from a scatter operation into a single VCF file
    GatherVcfsCloud                              (BETA Tool) Gathers multiple VCF files from a scatter operation into a single VCF file
    LeftAlignAndTrimVariants                     Left align and trim vairants
    LiftoverVcf (Picard)                         Lifts over a VCF file from one reference build to another.  
    MakeSitesOnlyVcf (Picard)                    Creates a VCF that contains all the site-level information for all records in the input VCF but no genotype information.
    MakeVcfSampleNameMap (Picard)                Creates a TSV from sample name to VCF/GVCF path, with one line per input.
    MergeVcfs (Picard)                           Combines multiple variant files into a single variant file
    PrintVariantsSpark                           Prints out variants from the input VCF.
    RemoveNearbyIndels                           (Internal) Remove indels from the VCF file that are close to each other.
    RenameSampleInVcf (Picard)                   Renames a sample within a VCF or BCF.
    SelectVariants                               Select a subset of variants from a VCF file
    SortVcf (Picard)                             Sorts one or more VCF files.  
    SplitVcfs (Picard)                           Splits SNPs and INDELs into separate files.  
    UpdateVCFSequenceDictionary                  Updates the sequence dictionary in a variant file.
    UpdateVcfSequenceDictionary (Picard)         Takes a VCF and a second file that contains a sequence dictionary and updates the VCF with the new sequence dictionary.
    VariantAnnotator                             Tool for adding annotations to VCF files
    VcfFormatConverter (Picard)                  Converts VCF to BCF or BCF to VCF.  
    VcfToIntervalList (Picard)                   Converts a VCF or BCF file to a Picard Interval List

--------------------------------------------------------------------------------------

***********************************************************************

A USER ERROR has occurred: '-Xmx104857M' is not a valid command.


***********************************************************************
Set the system property GATK_STACKTRACE_ON_USER_EXCEPTION (--java-options '-DGATK_STACKTRACE_ON_USER_EXCEPTION=true') to print the stack trace.
Using GATK jar /gatk/gatk-package-4.3.0.0-local.jar
Running:
    java -Dsamjdk.use_async_io_read_samtools=false -Dsamjdk.use_async_io_write_samtools=true -Dsamjdk.use_async_io_write_tribble=false -Dsamjdk.compression_level=2 -jar /gatk/gatk-package-4.3.0.0-local.jar -Xmx104857M SplitNCigarReads -R input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta -I output.temp/Le1-17-502-703_1.fastq.gz_addrg_repN.bam -O output2/Le1-17-502-703_1.fastq.gz.bam
++ onerror 62
++ status=123
++ script=/yoshitake/PortablePipeline/PortablePipeline/scripts/RNA-seq~SNPcall-bbmap-callvariants
++ line=62
++ shift
++ set +x

------------------------------------------------------------
Error occured on /yoshitake/PortablePipeline/PortablePipeline/scripts/RNA-seq~SNPcall-bbmap-callvariants [Line 62]: Status 123

PID: 406241
User: yoshitake.kazutoshi
Current directory: /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants
Command line: /yoshitake/PortablePipeline/PortablePipeline/scripts/RNA-seq~SNPcall-bbmap-callvariants 
------------------------------------------------------------

PID: 406239
pp runtime error.
Checking the realpath of input files.
0 input_1/
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-1-501-701_1.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-1-501-701_2.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-12-501-708_1.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-12-501-708_2.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-17-502-703_2.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-13-502-701_2.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-17-502-703_1.fastq.gz
1 /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/input_1/Le1-13-502-701_1.fastq.gz
0 input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
script: /yoshitake/PortablePipeline/PortablePipeline/scripts/RNA-seq~SNPcall-bbmap-callvariants "$scriptdir"/mapping-illumina~bbmap
broadinstitute/gatk:4.3.0.0 centos:centos6 quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1 quay.io/biocontainers/picard:2.18.27--0
using docker
+ set -o pipefail
++ date +%s
+ time0=1677628606
+ echo start at 1677628606
start at 1677628606
++ echo input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
++ grep '[.]gz$'
++ wc -l
++ true
+ '[' 0 = 1 ']'
+ ref=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
++ echo input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
++ sed 's/[.]\(fa\|fasta\|fsa\|fna\)$//'
+ refbase=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg
+ FUNC_RUN_DOCKER quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1 samtools faidx input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
+ PP_RUN_IMAGE=quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1
+ shift
+ PP_RUN_DOCKER_CMD=("${@}")
++ date +%Y%m%d_%H%M%S_%3N
+ PPDOCNAME=pp20230301_085646_962_10777
+ echo pp20230301_085646_962_10777
++ id -u
++ id -g
+ docker run --name pp20230301_085646_962_10777 -v /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants:/yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants -w /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1 samtools faidx input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta
+ rm -f input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.dict
+ FUNC_RUN_DOCKER quay.io/biocontainers/picard:2.18.27--0 picard -Xmx104857M CreateSequenceDictionary R=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta O=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.dict
+ PP_RUN_IMAGE=quay.io/biocontainers/picard:2.18.27--0
+ shift
+ PP_RUN_DOCKER_CMD=("${@}")
++ date +%Y%m%d_%H%M%S_%3N
+ PPDOCNAME=pp20230301_085647_842_32484
+ echo pp20230301_085647_842_32484
++ id -u
++ id -g
+ docker run --name pp20230301_085647_842_32484 -v /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants:/yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants -w /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants -u 2007:600 -i --rm quay.io/biocontainers/picard:2.18.27--0 picard -Xmx104857M CreateSequenceDictionary R=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta O=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.dict
/usr/local/bin/picard: line 5: warning: setlocale: LC_ALL: cannot change locale (en_US.UTF-8): No such file or directory
INFO	2023-02-28 23:56:48	CreateSequenceDictionary	

********** NOTE: Picard's command line syntax is changing.
**********
********** For more information, please see:
********** https://github.com/broadinstitute/picard/wiki/Command-Line-Syntax-Transition-For-Users-(Pre-Transition)
**********
********** The command line looks like this in the new syntax:
**********
**********    CreateSequenceDictionary -R input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta -O input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.dict
**********


23:56:49.237 INFO  NativeLibraryLoader - Loading libgkl_compression.so from jar:file:/usr/local/share/picard-2.18.27-0/picard.jar!/com/intel/gkl/native/libgkl_compression.so
[Tue Feb 28 23:56:49 GMT 2023] CreateSequenceDictionary OUTPUT=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.dict REFERENCE=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta    TRUNCATE_NAMES_AT_WHITESPACE=true NUM_SEQUENCES=2147483647 VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false GA4GH_CLIENT_SECRETS=client_secrets.json USE_JDK_DEFLATER=false USE_JDK_INFLATER=false
[Tue Feb 28 23:56:49 GMT 2023] Executing as ?@1efc84b0078e on Linux 3.10.0-1160.36.2.el7.x86_64 amd64; OpenJDK 64-Bit Server VM 11.0.1+13-LTS; Deflater: Intel; Inflater: Intel; Provider GCS is not available; Picard version: 2.18.27-SNAPSHOT
[Tue Feb 28 23:56:49 GMT 2023] picard.sam.CreateSequenceDictionary done. Elapsed time: 0.01 minutes.
Runtime.totalMemory()=2147483648
+ cat
+ mkdir -p output.temp output2
+ ls output/Le1-1-501-701_1.fastq.gz.bam output/Le1-12-501-708_1.fastq.gz.bam output/Le1-13-502-701_1.fastq.gz.bam output/Le1-17-502-703_1.fastq.gz.bam
+ read i
+ xargs '-d\n' -I '{}' -P 1 bash -c '{}'
++ basename output/Le1-1-501-701_1.fastq.gz.bam .bam
+ j=Le1-1-501-701_1.fastq.gz
+ echo -n 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/picard:2.18.27--0  picard -Xmx104857M AddOrReplaceReadGroups I="output/Le1-1-501-701_1.fastq.gz.bam" O=output.temp/"Le1-1-501-701_1.fastq.gz"_addrg.bam SO=coordinate RGID="Le1-1-501-701_1.fastq.gz" RGLB=library RGPL=Illumina RGPU=Illumina RGSM="Le1-1-501-701_1.fastq.gz"; '
+ echo -n '(PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools view -h output.temp/"Le1-1-501-701_1.fastq.gz"_addrg.bam)|bash run-awk-replace.sh|(PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools view -Sb -o output.temp/"Le1-1-501-701_1.fastq.gz"_addrg_repN.bam); '
+ echo -n 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools index output.temp/"Le1-1-501-701_1.fastq.gz"_addrg_repN.bam; '
+ echo 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm broadinstitute/gatk:4.3.0.0  gatk --java-options -Xmx104857M SplitNCigarReads -R "input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta" -I output.temp/"Le1-1-501-701_1.fastq.gz"_addrg_repN.bam -O output2/"Le1-1-501-701_1.fastq.gz".bam'
+ read i
++ basename output/Le1-12-501-708_1.fastq.gz.bam .bam
+ j=Le1-12-501-708_1.fastq.gz
+ echo -n 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/picard:2.18.27--0  picard -Xmx104857M AddOrReplaceReadGroups I="output/Le1-12-501-708_1.fastq.gz.bam" O=output.temp/"Le1-12-501-708_1.fastq.gz"_addrg.bam SO=coordinate RGID="Le1-12-501-708_1.fastq.gz" RGLB=library RGPL=Illumina RGPU=Illumina RGSM="Le1-12-501-708_1.fastq.gz"; '
+ echo -n '(PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools view -h output.temp/"Le1-12-501-708_1.fastq.gz"_addrg.bam)|bash run-awk-replace.sh|(PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools view -Sb -o output.temp/"Le1-12-501-708_1.fastq.gz"_addrg_repN.bam); '
+ echo -n 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools index output.temp/"Le1-12-501-708_1.fastq.gz"_addrg_repN.bam; '
+ echo 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm broadinstitute/gatk:4.3.0.0  gatk --java-options -Xmx104857M SplitNCigarReads -R "input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta" -I output.temp/"Le1-12-501-708_1.fastq.gz"_addrg_repN.bam -O output2/"Le1-12-501-708_1.fastq.gz".bam'
+ read i
++ basename output/Le1-13-502-701_1.fastq.gz.bam .bam
+ j=Le1-13-502-701_1.fastq.gz
+ echo -n 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/picard:2.18.27--0  picard -Xmx104857M AddOrReplaceReadGroups I="output/Le1-13-502-701_1.fastq.gz.bam" O=output.temp/"Le1-13-502-701_1.fastq.gz"_addrg.bam SO=coordinate RGID="Le1-13-502-701_1.fastq.gz" RGLB=library RGPL=Illumina RGPU=Illumina RGSM="Le1-13-502-701_1.fastq.gz"; '
+ echo -n '(PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools view -h output.temp/"Le1-13-502-701_1.fastq.gz"_addrg.bam)|bash run-awk-replace.sh|(PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools view -Sb -o output.temp/"Le1-13-502-701_1.fastq.gz"_addrg_repN.bam); '
+ echo -n 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools index output.temp/"Le1-13-502-701_1.fastq.gz"_addrg_repN.bam; '
+ echo 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm broadinstitute/gatk:4.3.0.0  gatk --java-options -Xmx104857M SplitNCigarReads -R "input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta" -I output.temp/"Le1-13-502-701_1.fastq.gz"_addrg_repN.bam -O output2/"Le1-13-502-701_1.fastq.gz".bam'
+ read i
++ basename output/Le1-17-502-703_1.fastq.gz.bam .bam
+ j=Le1-17-502-703_1.fastq.gz
+ echo -n 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/picard:2.18.27--0  picard -Xmx104857M AddOrReplaceReadGroups I="output/Le1-17-502-703_1.fastq.gz.bam" O=output.temp/"Le1-17-502-703_1.fastq.gz"_addrg.bam SO=coordinate RGID="Le1-17-502-703_1.fastq.gz" RGLB=library RGPL=Illumina RGPU=Illumina RGSM="Le1-17-502-703_1.fastq.gz"; '
+ echo -n '(PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools view -h output.temp/"Le1-17-502-703_1.fastq.gz"_addrg.bam)|bash run-awk-replace.sh|(PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools view -Sb -o output.temp/"Le1-17-502-703_1.fastq.gz"_addrg_repN.bam); '
+ echo -n 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1  samtools index output.temp/"Le1-17-502-703_1.fastq.gz"_addrg_repN.bam; '
+ echo 'PPDOCNAME=pp`date +%Y%m%d_%H%M%S_%3N`_$RANDOM; echo $PPDOCNAME >> /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants/pp-docker-list; docker run --name ${PPDOCNAME} -v $PWD:$PWD -w $PWD  -u 2007:600 -i --rm broadinstitute/gatk:4.3.0.0  gatk --java-options -Xmx104857M SplitNCigarReads -R "input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta" -I output.temp/"Le1-17-502-703_1.fastq.gz"_addrg_repN.bam -O output2/"Le1-17-502-703_1.fastq.gz".bam'
+ read i
/usr/local/bin/picard: line 5: warning: setlocale: LC_ALL: cannot change locale (en_US.UTF-8): No such file or directory
INFO	2023-02-28 23:56:50	AddOrReplaceReadGroups	

********** NOTE: Picard's command line syntax is changing.
**********
********** For more information, please see:
********** https://github.com/broadinstitute/picard/wiki/Command-Line-Syntax-Transition-For-Users-(Pre-Transition)
**********
********** The command line looks like this in the new syntax:
**********
**********    AddOrReplaceReadGroups -I output/Le1-1-501-701_1.fastq.gz.bam -O output.temp/Le1-1-501-701_1.fastq.gz_addrg.bam -SO coordinate -RGID Le1-1-501-701_1.fastq.gz -RGLB library -RGPL Illumina -RGPU Illumina -RGSM Le1-1-501-701_1.fastq.gz
**********


23:56:51.350 INFO  NativeLibraryLoader - Loading libgkl_compression.so from jar:file:/usr/local/share/picard-2.18.27-0/picard.jar!/com/intel/gkl/native/libgkl_compression.so
[Tue Feb 28 23:56:51 GMT 2023] AddOrReplaceReadGroups INPUT=output/Le1-1-501-701_1.fastq.gz.bam OUTPUT=output.temp/Le1-1-501-701_1.fastq.gz_addrg.bam SORT_ORDER=coordinate RGID=Le1-1-501-701_1.fastq.gz RGLB=library RGPL=Illumina RGPU=Illumina RGSM=Le1-1-501-701_1.fastq.gz    VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false GA4GH_CLIENT_SECRETS=client_secrets.json USE_JDK_DEFLATER=false USE_JDK_INFLATER=false
[Tue Feb 28 23:56:51 GMT 2023] Executing as ?@a7e757820c00 on Linux 3.10.0-1160.36.2.el7.x86_64 amd64; OpenJDK 64-Bit Server VM 11.0.1+13-LTS; Deflater: Intel; Inflater: Intel; Provider GCS is not available; Picard version: 2.18.27-SNAPSHOT
INFO	2023-02-28 23:56:51	AddOrReplaceReadGroups	Created read-group ID=Le1-1-501-701_1.fastq.gz PL=Illumina LB=library SM=Le1-1-501-701_1.fastq.gz

[Tue Feb 28 23:56:54 GMT 2023] picard.sam.AddOrReplaceReadGroups done. Elapsed time: 0.06 minutes.
Runtime.totalMemory()=2617245696
23:57:02.083 INFO  NativeLibraryLoader - Loading libgkl_compression.so from jar:file:/gatk/gatk-package-4.3.0.0-local.jar!/com/intel/gkl/native/libgkl_compression.so
23:57:02.265 INFO  SplitNCigarReads - ------------------------------------------------------------
23:57:02.266 INFO  SplitNCigarReads - The Genome Analysis Toolkit (GATK) v4.3.0.0
23:57:02.266 INFO  SplitNCigarReads - For support and documentation go to https://software.broadinstitute.org/gatk/
23:57:02.267 INFO  SplitNCigarReads - Executing as ?@190270ec2003 on Linux v3.10.0-1160.36.2.el7.x86_64 amd64
23:57:02.267 INFO  SplitNCigarReads - Java runtime: OpenJDK 64-Bit Server VM v1.8.0_242-8u242-b08-0ubuntu3~18.04-b08
23:57:02.267 INFO  SplitNCigarReads - Start Date/Time: February 28, 2023 11:57:02 PM GMT
23:57:02.268 INFO  SplitNCigarReads - ------------------------------------------------------------
23:57:02.268 INFO  SplitNCigarReads - ------------------------------------------------------------
23:57:02.269 INFO  SplitNCigarReads - HTSJDK Version: 3.0.1
23:57:02.269 INFO  SplitNCigarReads - Picard Version: 2.27.5
23:57:02.269 INFO  SplitNCigarReads - Built for Spark Version: 2.4.5
23:57:02.270 INFO  SplitNCigarReads - HTSJDK Defaults.COMPRESSION_LEVEL : 2
23:57:02.270 INFO  SplitNCigarReads - HTSJDK Defaults.USE_ASYNC_IO_READ_FOR_SAMTOOLS : false
23:57:02.270 INFO  SplitNCigarReads - HTSJDK Defaults.USE_ASYNC_IO_WRITE_FOR_SAMTOOLS : true
23:57:02.270 INFO  SplitNCigarReads - HTSJDK Defaults.USE_ASYNC_IO_WRITE_FOR_TRIBBLE : false
23:57:02.270 INFO  SplitNCigarReads - Deflater: IntelDeflater
23:57:02.271 INFO  SplitNCigarReads - Inflater: IntelInflater
23:57:02.271 INFO  SplitNCigarReads - GCS max retries/reopens: 20
23:57:02.271 INFO  SplitNCigarReads - Requester pays: disabled
23:57:02.271 INFO  SplitNCigarReads - Initializing engine
23:57:02.636 INFO  SplitNCigarReads - Done initializing engine
23:57:02.682 INFO  ProgressMeter - Starting traversal
23:57:02.682 INFO  ProgressMeter -        Current Locus  Elapsed Minutes       Reads Processed     Reads/Minute
23:57:04.595 WARN  IntelInflater - Zero Bytes Written : 0
23:57:04.598 INFO  SplitNCigarReads - 0 read(s) filtered by: AllowAllReadsReadFilter 

23:57:04.599 INFO  OverhangFixingManager - Overhang Fixing Manager saved 512 reads in the first pass
23:57:04.601 INFO  SplitNCigarReads - Starting traversal pass 2
23:57:06.700 WARN  IntelInflater - Zero Bytes Written : 0
23:57:06.701 INFO  SplitNCigarReads - 0 read(s) filtered by: AllowAllReadsReadFilter 

23:57:06.702 INFO  ProgressMeter -    h1tg000096l:21503              0.1                291848        4357024.1
23:57:06.702 INFO  ProgressMeter - Traversal complete. Processed 291848 total reads in 0.1 minutes.
23:57:07.655 INFO  SplitNCigarReads - Shutting down engine
[February 28, 2023 11:57:07 PM GMT] org.broadinstitute.hellbender.tools.walkers.rnaseq.SplitNCigarReads done. Elapsed time: 0.09 minutes.
Runtime.totalMemory()=2649751552
Using GATK jar /gatk/gatk-package-4.3.0.0-local.jar
Running:
    java -Dsamjdk.use_async_io_read_samtools=false -Dsamjdk.use_async_io_write_samtools=true -Dsamjdk.use_async_io_write_tribble=false -Dsamjdk.compression_level=2 -Xmx104857M -jar /gatk/gatk-package-4.3.0.0-local.jar SplitNCigarReads -R input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta -I output.temp/Le1-1-501-701_1.fastq.gz_addrg_repN.bam -O output2/Le1-1-501-701_1.fastq.gz.bam
/usr/local/bin/picard: line 5: warning: setlocale: LC_ALL: cannot change locale (en_US.UTF-8): No such file or directory
INFO	2023-02-28 23:57:09	AddOrReplaceReadGroups	

********** NOTE: Picard's command line syntax is changing.
**********
********** For more information, please see:
********** https://github.com/broadinstitute/picard/wiki/Command-Line-Syntax-Transition-For-Users-(Pre-Transition)
**********
********** The command line looks like this in the new syntax:
**********
**********    AddOrReplaceReadGroups -I output/Le1-12-501-708_1.fastq.gz.bam -O output.temp/Le1-12-501-708_1.fastq.gz_addrg.bam -SO coordinate -RGID Le1-12-501-708_1.fastq.gz -RGLB library -RGPL Illumina -RGPU Illumina -RGSM Le1-12-501-708_1.fastq.gz
**********


23:57:09.474 INFO  NativeLibraryLoader - Loading libgkl_compression.so from jar:file:/usr/local/share/picard-2.18.27-0/picard.jar!/com/intel/gkl/native/libgkl_compression.so
[Tue Feb 28 23:57:09 GMT 2023] AddOrReplaceReadGroups INPUT=output/Le1-12-501-708_1.fastq.gz.bam OUTPUT=output.temp/Le1-12-501-708_1.fastq.gz_addrg.bam SORT_ORDER=coordinate RGID=Le1-12-501-708_1.fastq.gz RGLB=library RGPL=Illumina RGPU=Illumina RGSM=Le1-12-501-708_1.fastq.gz    VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false GA4GH_CLIENT_SECRETS=client_secrets.json USE_JDK_DEFLATER=false USE_JDK_INFLATER=false
[Tue Feb 28 23:57:09 GMT 2023] Executing as ?@8ed77b40bd2d on Linux 3.10.0-1160.36.2.el7.x86_64 amd64; OpenJDK 64-Bit Server VM 11.0.1+13-LTS; Deflater: Intel; Inflater: Intel; Provider GCS is not available; Picard version: 2.18.27-SNAPSHOT
INFO	2023-02-28 23:57:09	AddOrReplaceReadGroups	Created read-group ID=Le1-12-501-708_1.fastq.gz PL=Illumina LB=library SM=Le1-12-501-708_1.fastq.gz

[Tue Feb 28 23:57:10 GMT 2023] picard.sam.AddOrReplaceReadGroups done. Elapsed time: 0.01 minutes.
Runtime.totalMemory()=2147483648
23:57:15.597 INFO  NativeLibraryLoader - Loading libgkl_compression.so from jar:file:/gatk/gatk-package-4.3.0.0-local.jar!/com/intel/gkl/native/libgkl_compression.so
23:57:15.754 INFO  SplitNCigarReads - ------------------------------------------------------------
23:57:15.755 INFO  SplitNCigarReads - The Genome Analysis Toolkit (GATK) v4.3.0.0
23:57:15.755 INFO  SplitNCigarReads - For support and documentation go to https://software.broadinstitute.org/gatk/
23:57:15.755 INFO  SplitNCigarReads - Executing as ?@bb566256d80e on Linux v3.10.0-1160.36.2.el7.x86_64 amd64
23:57:15.756 INFO  SplitNCigarReads - Java runtime: OpenJDK 64-Bit Server VM v1.8.0_242-8u242-b08-0ubuntu3~18.04-b08
23:57:15.756 INFO  SplitNCigarReads - Start Date/Time: February 28, 2023 11:57:15 PM GMT
23:57:15.756 INFO  SplitNCigarReads - ------------------------------------------------------------
23:57:15.756 INFO  SplitNCigarReads - ------------------------------------------------------------
23:57:15.757 INFO  SplitNCigarReads - HTSJDK Version: 3.0.1
23:57:15.757 INFO  SplitNCigarReads - Picard Version: 2.27.5
23:57:15.757 INFO  SplitNCigarReads - Built for Spark Version: 2.4.5
23:57:15.757 INFO  SplitNCigarReads - HTSJDK Defaults.COMPRESSION_LEVEL : 2
23:57:15.757 INFO  SplitNCigarReads - HTSJDK Defaults.USE_ASYNC_IO_READ_FOR_SAMTOOLS : false
23:57:15.757 INFO  SplitNCigarReads - HTSJDK Defaults.USE_ASYNC_IO_WRITE_FOR_SAMTOOLS : true
23:57:15.758 INFO  SplitNCigarReads - HTSJDK Defaults.USE_ASYNC_IO_WRITE_FOR_TRIBBLE : false
23:57:15.758 INFO  SplitNCigarReads - Deflater: IntelDeflater
23:57:15.758 INFO  SplitNCigarReads - Inflater: IntelInflater
23:57:15.758 INFO  SplitNCigarReads - GCS max retries/reopens: 20
23:57:15.758 INFO  SplitNCigarReads - Requester pays: disabled
23:57:15.758 INFO  SplitNCigarReads - Initializing engine
23:57:16.123 INFO  SplitNCigarReads - Done initializing engine
23:57:16.170 INFO  ProgressMeter - Starting traversal
23:57:16.171 INFO  ProgressMeter -        Current Locus  Elapsed Minutes       Reads Processed     Reads/Minute
23:57:16.973 WARN  IntelInflater - Zero Bytes Written : 0
23:57:16.976 INFO  SplitNCigarReads - 0 read(s) filtered by: AllowAllReadsReadFilter 

23:57:16.976 INFO  OverhangFixingManager - Overhang Fixing Manager saved 54 reads in the first pass
23:57:16.979 INFO  SplitNCigarReads - Starting traversal pass 2
23:57:17.468 WARN  IntelInflater - Zero Bytes Written : 0
23:57:17.469 INFO  SplitNCigarReads - 0 read(s) filtered by: AllowAllReadsReadFilter 

23:57:17.470 INFO  ProgressMeter -   h1tg000069l:128641              0.0                 36932        1707180.3
23:57:17.471 INFO  ProgressMeter - Traversal complete. Processed 36932 total reads in 0.0 minutes.
23:57:17.720 INFO  SplitNCigarReads - Shutting down engine
[February 28, 2023 11:57:17 PM GMT] org.broadinstitute.hellbender.tools.walkers.rnaseq.SplitNCigarReads done. Elapsed time: 0.04 minutes.
Runtime.totalMemory()=2528641024
Using GATK jar /gatk/gatk-package-4.3.0.0-local.jar
Running:
    java -Dsamjdk.use_async_io_read_samtools=false -Dsamjdk.use_async_io_write_samtools=true -Dsamjdk.use_async_io_write_tribble=false -Dsamjdk.compression_level=2 -Xmx104857M -jar /gatk/gatk-package-4.3.0.0-local.jar SplitNCigarReads -R input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta -I output.temp/Le1-12-501-708_1.fastq.gz_addrg_repN.bam -O output2/Le1-12-501-708_1.fastq.gz.bam
/usr/local/bin/picard: line 5: warning: setlocale: LC_ALL: cannot change locale (en_US.UTF-8): No such file or directory
INFO	2023-02-28 23:57:18	AddOrReplaceReadGroups	

********** NOTE: Picard's command line syntax is changing.
**********
********** For more information, please see:
********** https://github.com/broadinstitute/picard/wiki/Command-Line-Syntax-Transition-For-Users-(Pre-Transition)
**********
********** The command line looks like this in the new syntax:
**********
**********    AddOrReplaceReadGroups -I output/Le1-13-502-701_1.fastq.gz.bam -O output.temp/Le1-13-502-701_1.fastq.gz_addrg.bam -SO coordinate -RGID Le1-13-502-701_1.fastq.gz -RGLB library -RGPL Illumina -RGPU Illumina -RGSM Le1-13-502-701_1.fastq.gz
**********


23:57:19.401 INFO  NativeLibraryLoader - Loading libgkl_compression.so from jar:file:/usr/local/share/picard-2.18.27-0/picard.jar!/com/intel/gkl/native/libgkl_compression.so
[Tue Feb 28 23:57:19 GMT 2023] AddOrReplaceReadGroups INPUT=output/Le1-13-502-701_1.fastq.gz.bam OUTPUT=output.temp/Le1-13-502-701_1.fastq.gz_addrg.bam SORT_ORDER=coordinate RGID=Le1-13-502-701_1.fastq.gz RGLB=library RGPL=Illumina RGPU=Illumina RGSM=Le1-13-502-701_1.fastq.gz    VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false GA4GH_CLIENT_SECRETS=client_secrets.json USE_JDK_DEFLATER=false USE_JDK_INFLATER=false
[Tue Feb 28 23:57:19 GMT 2023] Executing as ?@8b08e65aee13 on Linux 3.10.0-1160.36.2.el7.x86_64 amd64; OpenJDK 64-Bit Server VM 11.0.1+13-LTS; Deflater: Intel; Inflater: Intel; Provider GCS is not available; Picard version: 2.18.27-SNAPSHOT
INFO	2023-02-28 23:57:19	AddOrReplaceReadGroups	Created read-group ID=Le1-13-502-701_1.fastq.gz PL=Illumina LB=library SM=Le1-13-502-701_1.fastq.gz

[Tue Feb 28 23:57:24 GMT 2023] picard.sam.AddOrReplaceReadGroups done. Elapsed time: 0.09 minutes.
Runtime.totalMemory()=2650800128
23:57:33.470 INFO  NativeLibraryLoader - Loading libgkl_compression.so from jar:file:/gatk/gatk-package-4.3.0.0-local.jar!/com/intel/gkl/native/libgkl_compression.so
23:57:33.619 INFO  SplitNCigarReads - ------------------------------------------------------------
23:57:33.619 INFO  SplitNCigarReads - The Genome Analysis Toolkit (GATK) v4.3.0.0
23:57:33.619 INFO  SplitNCigarReads - For support and documentation go to https://software.broadinstitute.org/gatk/
23:57:33.619 INFO  SplitNCigarReads - Executing as ?@d4eecf8c91c6 on Linux v3.10.0-1160.36.2.el7.x86_64 amd64
23:57:33.620 INFO  SplitNCigarReads - Java runtime: OpenJDK 64-Bit Server VM v1.8.0_242-8u242-b08-0ubuntu3~18.04-b08
23:57:33.620 INFO  SplitNCigarReads - Start Date/Time: February 28, 2023 11:57:33 PM GMT
23:57:33.620 INFO  SplitNCigarReads - ------------------------------------------------------------
23:57:33.620 INFO  SplitNCigarReads - ------------------------------------------------------------
23:57:33.621 INFO  SplitNCigarReads - HTSJDK Version: 3.0.1
23:57:33.621 INFO  SplitNCigarReads - Picard Version: 2.27.5
23:57:33.621 INFO  SplitNCigarReads - Built for Spark Version: 2.4.5
23:57:33.621 INFO  SplitNCigarReads - HTSJDK Defaults.COMPRESSION_LEVEL : 2
23:57:33.621 INFO  SplitNCigarReads - HTSJDK Defaults.USE_ASYNC_IO_READ_FOR_SAMTOOLS : false
23:57:33.621 INFO  SplitNCigarReads - HTSJDK Defaults.USE_ASYNC_IO_WRITE_FOR_SAMTOOLS : true
23:57:33.621 INFO  SplitNCigarReads - HTSJDK Defaults.USE_ASYNC_IO_WRITE_FOR_TRIBBLE : false
23:57:33.621 INFO  SplitNCigarReads - Deflater: IntelDeflater
23:57:33.621 INFO  SplitNCigarReads - Inflater: IntelInflater
23:57:33.621 INFO  SplitNCigarReads - GCS max retries/reopens: 20
23:57:33.621 INFO  SplitNCigarReads - Requester pays: disabled
23:57:33.621 INFO  SplitNCigarReads - Initializing engine
23:57:33.964 INFO  SplitNCigarReads - Done initializing engine
23:57:34.001 INFO  ProgressMeter - Starting traversal
23:57:34.002 INFO  ProgressMeter -        Current Locus  Elapsed Minutes       Reads Processed     Reads/Minute
23:57:37.245 WARN  IntelInflater - Zero Bytes Written : 0
23:57:37.247 INFO  SplitNCigarReads - 0 read(s) filtered by: AllowAllReadsReadFilter 

23:57:37.248 INFO  OverhangFixingManager - Overhang Fixing Manager saved 1984 reads in the first pass
23:57:37.250 INFO  SplitNCigarReads - Starting traversal pass 2
23:57:40.982 WARN  IntelInflater - Zero Bytes Written : 0
23:57:40.983 INFO  SplitNCigarReads - 0 read(s) filtered by: AllowAllReadsReadFilter 

23:57:40.984 INFO  ProgressMeter -             unmapped              0.1                491400        4223463.7
23:57:40.984 INFO  ProgressMeter - Traversal complete. Processed 491400 total reads in 0.1 minutes.
23:57:42.424 INFO  SplitNCigarReads - Shutting down engine
[February 28, 2023 11:57:42 PM GMT] org.broadinstitute.hellbender.tools.walkers.rnaseq.SplitNCigarReads done. Elapsed time: 0.15 minutes.
Runtime.totalMemory()=2900885504
Using GATK jar /gatk/gatk-package-4.3.0.0-local.jar
Running:
    java -Dsamjdk.use_async_io_read_samtools=false -Dsamjdk.use_async_io_write_samtools=true -Dsamjdk.use_async_io_write_tribble=false -Dsamjdk.compression_level=2 -Xmx104857M -jar /gatk/gatk-package-4.3.0.0-local.jar SplitNCigarReads -R input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta -I output.temp/Le1-13-502-701_1.fastq.gz_addrg_repN.bam -O output2/Le1-13-502-701_1.fastq.gz.bam
/usr/local/bin/picard: line 5: warning: setlocale: LC_ALL: cannot change locale (en_US.UTF-8): No such file or directory
INFO	2023-02-28 23:57:43	AddOrReplaceReadGroups	

********** NOTE: Picard's command line syntax is changing.
**********
********** For more information, please see:
********** https://github.com/broadinstitute/picard/wiki/Command-Line-Syntax-Transition-For-Users-(Pre-Transition)
**********
********** The command line looks like this in the new syntax:
**********
**********    AddOrReplaceReadGroups -I output/Le1-17-502-703_1.fastq.gz.bam -O output.temp/Le1-17-502-703_1.fastq.gz_addrg.bam -SO coordinate -RGID Le1-17-502-703_1.fastq.gz -RGLB library -RGPL Illumina -RGPU Illumina -RGSM Le1-17-502-703_1.fastq.gz
**********


23:57:44.226 INFO  NativeLibraryLoader - Loading libgkl_compression.so from jar:file:/usr/local/share/picard-2.18.27-0/picard.jar!/com/intel/gkl/native/libgkl_compression.so
[Tue Feb 28 23:57:44 GMT 2023] AddOrReplaceReadGroups INPUT=output/Le1-17-502-703_1.fastq.gz.bam OUTPUT=output.temp/Le1-17-502-703_1.fastq.gz_addrg.bam SORT_ORDER=coordinate RGID=Le1-17-502-703_1.fastq.gz RGLB=library RGPL=Illumina RGPU=Illumina RGSM=Le1-17-502-703_1.fastq.gz    VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false GA4GH_CLIENT_SECRETS=client_secrets.json USE_JDK_DEFLATER=false USE_JDK_INFLATER=false
[Tue Feb 28 23:57:44 GMT 2023] Executing as ?@71e2a21c6f0b on Linux 3.10.0-1160.36.2.el7.x86_64 amd64; OpenJDK 64-Bit Server VM 11.0.1+13-LTS; Deflater: Intel; Inflater: Intel; Provider GCS is not available; Picard version: 2.18.27-SNAPSHOT
INFO	2023-02-28 23:57:44	AddOrReplaceReadGroups	Created read-group ID=Le1-17-502-703_1.fastq.gz PL=Illumina LB=library SM=Le1-17-502-703_1.fastq.gz

[Tue Feb 28 23:57:58 GMT 2023] picard.sam.AddOrReplaceReadGroups done. Elapsed time: 0.23 minutes.
Runtime.totalMemory()=2583691264
23:58:14.002 INFO  NativeLibraryLoader - Loading libgkl_compression.so from jar:file:/gatk/gatk-package-4.3.0.0-local.jar!/com/intel/gkl/native/libgkl_compression.so
23:58:14.183 INFO  SplitNCigarReads - ------------------------------------------------------------
23:58:14.184 INFO  SplitNCigarReads - The Genome Analysis Toolkit (GATK) v4.3.0.0
23:58:14.184 INFO  SplitNCigarReads - For support and documentation go to https://software.broadinstitute.org/gatk/
23:58:14.184 INFO  SplitNCigarReads - Executing as ?@acb80e86b8fa on Linux v3.10.0-1160.36.2.el7.x86_64 amd64
23:58:14.184 INFO  SplitNCigarReads - Java runtime: OpenJDK 64-Bit Server VM v1.8.0_242-8u242-b08-0ubuntu3~18.04-b08
23:58:14.184 INFO  SplitNCigarReads - Start Date/Time: February 28, 2023 11:58:13 PM GMT
23:58:14.185 INFO  SplitNCigarReads - ------------------------------------------------------------
23:58:14.185 INFO  SplitNCigarReads - ------------------------------------------------------------
23:58:14.185 INFO  SplitNCigarReads - HTSJDK Version: 3.0.1
23:58:14.186 INFO  SplitNCigarReads - Picard Version: 2.27.5
23:58:14.186 INFO  SplitNCigarReads - Built for Spark Version: 2.4.5
23:58:14.186 INFO  SplitNCigarReads - HTSJDK Defaults.COMPRESSION_LEVEL : 2
23:58:14.186 INFO  SplitNCigarReads - HTSJDK Defaults.USE_ASYNC_IO_READ_FOR_SAMTOOLS : false
23:58:14.186 INFO  SplitNCigarReads - HTSJDK Defaults.USE_ASYNC_IO_WRITE_FOR_SAMTOOLS : true
23:58:14.186 INFO  SplitNCigarReads - HTSJDK Defaults.USE_ASYNC_IO_WRITE_FOR_TRIBBLE : false
23:58:14.186 INFO  SplitNCigarReads - Deflater: IntelDeflater
23:58:14.186 INFO  SplitNCigarReads - Inflater: IntelInflater
23:58:14.186 INFO  SplitNCigarReads - GCS max retries/reopens: 20
23:58:14.186 INFO  SplitNCigarReads - Requester pays: disabled
23:58:14.186 INFO  SplitNCigarReads - Initializing engine
23:58:14.557 INFO  SplitNCigarReads - Done initializing engine
23:58:14.607 INFO  ProgressMeter - Starting traversal
23:58:14.607 INFO  ProgressMeter -        Current Locus  Elapsed Minutes       Reads Processed     Reads/Minute
23:58:24.475 WARN  IntelInflater - Zero Bytes Written : 0
23:58:24.477 INFO  SplitNCigarReads - 0 read(s) filtered by: AllowAllReadsReadFilter 

23:58:24.478 INFO  OverhangFixingManager - Overhang Fixing Manager saved 5569 reads in the first pass
23:58:24.479 INFO  SplitNCigarReads - Starting traversal pass 2
23:58:24.616 INFO  ProgressMeter -   h1tg000001l:746357              0.2                695000        4167083.0
23:58:37.192 INFO  ProgressMeter -   h1tg000051l:135989              0.4               1240000        3294367.7
23:58:39.277 WARN  IntelInflater - Zero Bytes Written : 0
23:58:39.278 INFO  SplitNCigarReads - 0 read(s) filtered by: AllowAllReadsReadFilter 

23:58:39.278 INFO  ProgressMeter -    h1tg000097l:38077              0.4               1352628        3289731.7
23:58:39.278 INFO  ProgressMeter - Traversal complete. Processed 1352628 total reads in 0.4 minutes.
23:58:42.243 INFO  SplitNCigarReads - Shutting down engine
[February 28, 2023 11:58:42 PM GMT] org.broadinstitute.hellbender.tools.walkers.rnaseq.SplitNCigarReads done. Elapsed time: 0.47 minutes.
Runtime.totalMemory()=5519179776
Using GATK jar /gatk/gatk-package-4.3.0.0-local.jar
Running:
    java -Dsamjdk.use_async_io_read_samtools=false -Dsamjdk.use_async_io_write_samtools=true -Dsamjdk.use_async_io_write_tribble=false -Dsamjdk.compression_level=2 -Xmx104857M -jar /gatk/gatk-package-4.3.0.0-local.jar SplitNCigarReads -R input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta -I output.temp/Le1-17-502-703_1.fastq.gz_addrg_repN.bam -O output2/Le1-17-502-703_1.fastq.gz.bam
+ inputbams=
+ multiflag=
++ ls output2/Le1-1-501-701_1.fastq.gz.bam output2/Le1-12-501-708_1.fastq.gz.bam output2/Le1-13-502-701_1.fastq.gz.bam output2/Le1-17-502-703_1.fastq.gz.bam
+ for i in '`ls output2/*.bam`'
+ '[' '' = '' ']'
+ inputbams=output2/Le1-1-501-701_1.fastq.gz.bam
+ for i in '`ls output2/*.bam`'
+ '[' output2/Le1-1-501-701_1.fastq.gz.bam = '' ']'
+ multiflag=multisample=t
+ inputbams+=,output2/Le1-12-501-708_1.fastq.gz.bam
+ for i in '`ls output2/*.bam`'
+ '[' output2/Le1-1-501-701_1.fastq.gz.bam,output2/Le1-12-501-708_1.fastq.gz.bam = '' ']'
+ multiflag=multisample=t
+ inputbams+=,output2/Le1-13-502-701_1.fastq.gz.bam
+ for i in '`ls output2/*.bam`'
+ '[' output2/Le1-1-501-701_1.fastq.gz.bam,output2/Le1-12-501-708_1.fastq.gz.bam,output2/Le1-13-502-701_1.fastq.gz.bam = '' ']'
+ multiflag=multisample=t
+ inputbams+=,output2/Le1-17-502-703_1.fastq.gz.bam
+ FUNC_RUN_DOCKER quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1 callvariants.sh -Xmx104857M in=output2/Le1-1-501-701_1.fastq.gz.bam,output2/Le1-12-501-708_1.fastq.gz.bam,output2/Le1-13-502-701_1.fastq.gz.bam,output2/Le1-17-502-703_1.fastq.gz.bam ref=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta vcf=output.vcf multisample=t ploidy=2
+ PP_RUN_IMAGE=quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1
+ shift
+ PP_RUN_DOCKER_CMD=("${@}")
++ date +%Y%m%d_%H%M%S_%3N
+ PPDOCNAME=pp20230301_085842_649_26537
+ echo pp20230301_085842_649_26537
++ id -u
++ id -g
+ docker run --name pp20230301_085842_649_26537 -v /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants:/yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants -w /yoshitake/test/RNA-seq~SNPcall-bbmap-callvariants -u 2007:600 -i --rm quay.io/biocontainers/bbmap:38.96--h5c4e2a8_1 callvariants.sh -Xmx104857M in=output2/Le1-1-501-701_1.fastq.gz.bam,output2/Le1-12-501-708_1.fastq.gz.bam,output2/Le1-13-502-701_1.fastq.gz.bam,output2/Le1-17-502-703_1.fastq.gz.bam ref=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta vcf=output.vcf multisample=t ploidy=2
java -ea -Xmx104857M -Xms104857M -cp /usr/local/opt/bbmap-38.96-1/current/ var2.CallVariants -Xmx104857M in=output2/Le1-1-501-701_1.fastq.gz.bam,output2/Le1-12-501-708_1.fastq.gz.bam,output2/Le1-13-502-701_1.fastq.gz.bam,output2/Le1-17-502-703_1.fastq.gz.bam ref=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta vcf=output.vcf multisample=t ploidy=2
Executing var2.CallVariants2 [-Xmx104857M, in=output2/Le1-1-501-701_1.fastq.gz.bam,output2/Le1-12-501-708_1.fastq.gz.bam,output2/Le1-13-502-701_1.fastq.gz.bam,output2/Le1-17-502-703_1.fastq.gz.bam, ref=input_2/Shiitake_XR1.asm.bp.hap1.p_ctg.fasta, vcf=output.vcf, multisample=t, ploidy=2]

Calculating which variants pass filters.
Processing sample Le1-1-501-701_1.
Loading variants.
Could not find sambamba.
Found samtools 1.15
Time: 	1.830 seconds.

Processing variants.
Time: 	0.234 seconds.

Counting nearby variants.
Time: 	0.065 seconds.

Processing sample Le1-12-501-708_1.
Loading variants.
Time: 	0.087 seconds.

Processing variants.
Time: 	0.020 seconds.

Counting nearby variants.
Time: 	0.003 seconds.

Processing sample Le1-13-502-701_1.
Loading variants.
Time: 	0.484 seconds.

Processing variants.
Time: 	0.047 seconds.

Counting nearby variants.
Time: 	0.032 seconds.

Processing sample Le1-17-502-703_1.
Loading variants.
Time: 	1.155 seconds.

Processing variants.
Time: 	0.182 seconds.

Counting nearby variants.
Time: 	0.107 seconds.

100676 variants passed filters.	4.370 seconds.
Processing second pass.
Processing sample Le1-1-501-701_1.
Loading variants.
Time: 	0.366 seconds.

Processing variants.
Time: 	0.195 seconds.

Processing sample Le1-12-501-708_1.
Loading variants.
Time: 	0.115 seconds.

Processing variants.
Time: 	0.085 seconds.

Processing sample Le1-13-502-701_1.
Loading variants.
Time: 	0.435 seconds.

Processing variants.
Time: 	0.083 seconds.

Processing sample Le1-17-502-703_1.
Loading variants.
Time: 	1.151 seconds.

Processing variants.
Time: 	0.118 seconds.

Finished second pass.
Writing output.
Merging [(Le1-1-501-701_1, individual_Le1-1-501-701_1.vcf.gz), (Le1-12-501-708_1, individual_Le1-12-501-708_1.vcf.gz), (Le1-13-502-701_1, individual_Le1-13-502-701_1.vcf.gz), (Le1-17-502-703_1, individual_Le1-17-502-703_1.vcf.gz)]
Time: 	1.531 seconds.

100676 of 1912649 variants passed filters (5.2637%).

Substitutions: 	90317	89.7%
Deletions:     	5743	5.7%
Insertions:    	4616	4.6%
Variation Rate:	1/539

Time:                         	10.320 seconds.
Reads Processed:       1034k 	100.27k reads/sec
Bases Processed:        156m 	15.14m bases/sec
++ date
+ echo completion at 2023年 3月 1日 水曜日 08:58:54 JST
completion at 2023年 3月 1日 水曜日 08:58:54 JST
++ date +%s
+ time_fin=1677628734
++ echo 'scale=2; (1677628734 - 1677628606)/60'
++ bc
+ echo -e 'Total running time is 2.13 min'
Total running time is 2.13 min
+ echo 'Run completed!'
Run completed!
+ post_processing
+ '[' 1 = 1 ']'
+ echo 0
+ exit
PID: 412203